von Willebrand factor (VWF) - 976 nt intron 48 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.176235
gtaggagcaagctgaatgcagggctccctcacatatcaccatcttgcttccttttttgga  c.7986+60

         .         .         .         .         .         .  g.176295
aatttttcttcaaggaagaggggctaagtttggttcagtattggcttctttttctatttc  c.7986+120

         .         .         .         .         .         .  g.176355
tttctgattatataaagaaaagatagatgacttattgcaggcacagaattttctctttta  c.7986+180

         .         .         .         .         .         .  g.176415
tttagttattttgttgctcttcttgacaagagtgtacttggtgtagggcctcacaatttg  c.7986+240

         .         .         .         .         .         .  g.176475
gagttgattgatcttttttttttctttcttgagatggagtcttgctctgttgccaggctg  c.7986+300

         .         .         .         .         .         .  g.176535
gagtgcaatgtcacgatctcggctcactgcaacctccgcctcctgggttcaagcgatttc  c.7986+360

         .         .         .         .         .         .  g.176595
cctgtctcagcctcccgagtagctgggactgcaggcacgtgccaccacacccagctaatt  c.7986+420

         .         .         .         .         .         .  g.176655
tttgtagttttagtagagatgggatttcatcatgttggccaggatggtctcgatctcttg  c.7986+480

          g.176663
acctcgtg  c.7986+488

--------------------- middle of intron ---------------------
                                        g.176664              g.176671
                                        c.7987-488  atccgccc  c.7987-481

.         .         .         .         .         .           g.176731
acctcggcctcccaaagtgctgggattacaggtgtgagccaccgtgcctggcctggaggt  c.7987-421

.         .         .         .         .         .           g.176791
ggttgatctttaagattttctctacccttgggcgtctgtaagactggacaggccatcagc  c.7987-361

.         .         .         .         .         .           g.176851
gtgaaacaaactctggtctatgaagtccggactagctggtggggctgggaggtagttccc  c.7987-301

.         .         .         .         .         .           g.176911
ttcgttcatctctagttcagttatcagctagccagtttactgttgctatatctcaatcct  c.7987-241

.         .         .         .         .         .           g.176971
tcaagcatttaactggtcggaagagtctacatagcagccctgttcataggatacaagctg  c.7987-181

.         .         .         .         .         .           g.177031
taaaactgggactccacttctggtctgtgttctgggtgtgggggctttattatacactgt  c.7987-121

.         .         .         .         .         .           g.177091
cttcttgtttcatggttctgcagattgtttcgtcatctccatggagtcaagctcatggtt  c.7987-61

.         .         .         .         .         .           g.177151
tgaagtggctttgtgaaccaaacactgtctctgactttacccactcctctttccttccag  c.7987-1


Powered by LOVD v.2.0 Build 28
©2004-2010 Leiden University Medical Center