von Willebrand factor (VWF) - 524 nt intron 46 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.161604
gtgagccgctgtcctcttctccagagcaagtggtggggacagggaagggggtactgtggg  c.7770+60

         .         .         .         .         .         .  g.161664
aaggggagcaggcaagtcattgtaaagcagaaatgaaggaaaccagagagacccaacccc  c.7770+120

         .         .         .         .         .         .  g.161724
agctttccactgcctgtgggacgtgcctggcatcatggagcccaggctaggaccatcttc  c.7770+180

         .         .         .         .         .         .  g.161784
ctgactctccgggcctgtctcacactcacttcctggcccccacctcaggcacctgtgcat  c.7770+240

         .         .    g.161806
ttcttctgtgtgcagagaagca  c.7770+262

--------------------- middle of intron ---------------------
                          g.161807      .         .           g.161828
                          c.7771-262  ctctgaagtcattgtgcacgtt  c.7771-241

.         .         .         .         .         .           g.161888
ttagtttgtcccctctgccactacctgggctgcctctttggcatgaaagttctcactctt  c.7771-181

.         .         .         .         .         .           g.161948
accatcttgatactggaggtgggaggacgggaaggcagtgggccataggagacaggagga  c.7771-121

.         .         .         .         .         .           g.162008
gcagcagagcgatggctcatgggagctatgggtgggtgggcaggagacagggtatgagag  c.7771-61

.         .         .         .         .         .           g.162068
tgaggtgagtggggggttgggggatgctggggggcctgaccctggtgcctctgcttccag  c.7771-1


Powered by LOVD v.2.0 Build 28
©2004-2010 Leiden University Medical Center