von Willebrand factor (VWF) - 1043 nt intron 45 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.160520
gtaaggcatgcaggctggggctgggctggaccgggcaccacctttaagcctctctttcca  c.7729+60

         .         .         .         .         .         .  g.160580
cttttggctcctgaattctttgcctttttagcaacttagggaaatggataggaccgaaat  c.7729+120

         .         .         .         .         .         .  g.160640
cttcccatctgctcctactgcttttatgagaaagcaaattaaatgggaaaaccataggaa  c.7729+180

         .         .         .         .         .         .  g.160700
tttcctgaagatcactacatggcaagactgggattcggccctaggcttctctgatttgga  c.7729+240

         .         .         .         .         .         .  g.160760
gaccacctttgaaatgctgtgacgtttcacccaggggaaggcgttcaacttgccacccca  c.7729+300

         .         .         .         .         .         .  g.160820
acgctgccaacaaacagaaaaatggcaacaacaacaaaaactagttctttctaccatatc  c.7729+360

         .         .         .         .         .         .  g.160880
ctgctctgaattttatttatttgtttgtttgtttgtttgaggcagattctcactctggag  c.7729+420

         .         .         .         .         .         .  g.160940
tgactggcgctatctctggataggctagagtgcagtggcactattttggctcactgcaac  c.7729+480

         .         .         .         .    g.160982
cttggcctcctgggttcaagcacttttcctgcctcagcctcc  c.7729+522

--------------------- middle of intron ---------------------
       g.160983     .         .         .         .           g.161023
       c.7730-521  aagtagctgggattacaggcgtgcgccaccacactcggcta  c.7730-481

.         .         .         .         .         .           g.161083
atttttgtatttctagtagagatgtggttttgctatgttggctgggctggtcttgaactc  c.7730-421

.         .         .         .         .         .           g.161143
ctgacctcaagtgatctgcccacctcggcctcccagagtgctgggattacaggcatgagc  c.7730-361

.         .         .         .         .         .           g.161203
cactgtgcctggccactgaattcttgaaactgaaattttcaagagtagcgtttcattgtt  c.7730-301

.         .         .         .         .         .           g.161263
tcataaacccaaacatcctcccattcatcccatctcttaaatgtaaattcacataagcaa  c.7730-241

.         .         .         .         .         .           g.161323
gcgctgtcacttggagaacgtacggggctcttctcattgtgggctgcatggggaagggag  c.7730-181

.         .         .         .         .         .           g.161383
gccgctgtgggctccagcagtaggacccccagcgctgggttgtggggtggggggaaaggg  c.7730-121

.         .         .         .         .         .           g.161443
ccgaccgatacaggagggaggcccagacacggaggaggagccccaaagagagcagcctgc  c.7730-61

.         .         .         .         .         .           g.161503
tcgccggtctcaccagggtgtgttttgcccactctcactctgcacttttctctcccccag  c.7730-1


Powered by LOVD v.2.0 Build 28
©2004-2010 Leiden University Medical Center