von Willebrand factor (VWF) - 2207 nt intron 44 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.158132
gtaggtccaggcccccgggacggggaggagggcagattggggccactccagggaccagcg  c.7548+60

         .         .         .         .         .         .  g.158192
ttgaccttggtttcatctcattccctgccctttgctttccccactgggcatttcacccag  c.7548+120

         .         .         .         .         .         .  g.158252
ctgttggtgttatccagatgccagctgggatgacctgccccttaggaaccagttaagacg  c.7548+180

         .         .         .         .         .         .  g.158312
gcctcagccttcccattttgtagattttgggagaagcccagggccctcccagggggattc  c.7548+240

         .         .         .         .         .         .  g.158372
atgctctctcattcacctgtgaatctgaggtgctgtggctgaggggctggttttgggatg  c.7548+300

         .         .         .         .         .         .  g.158432
gcctcaccacccctccaaagtgccacaggctgcaagtactgttctggaccacatcaaccc  c.7548+360

         .         .         .         .         .         .  g.158492
aggcagggtcctcagaccttttcactgatttctactgaaacctccttggtggttttaggg  c.7548+420

         .         .         .         .         .         .  g.158552
aggtggaaacctttacaacccagaaaaggaacagtatttcccacagtccctctgctattt  c.7548+480

         .         .         .         .         .         .  g.158612
ctgcaggtctggctggggcatcttgccagccccccattgccccactcttgtcctctcctg  c.7548+540

         .         .         .         .         .         .  g.158672
gctggctcacccccgccagtcccttcttctaacacagagcagttcagctgtcccccatgt  c.7548+600

         .         .         .         .         .         .  g.158732
gctgccaggttctctcttagactctgatgctcatcaagccattttcttaaacacagagga  c.7548+660

         .         .         .         .         .         .  g.158792
ttccgtctttggcggttttagtccagatgctaggagaatcacagttctttcagtctggtc  c.7548+720

         .         .         .         .         .         .  g.158852
agaaggataaggtgggtggtgccaagtcctggcagccttgggagctggtgctgggaacag  c.7548+780

         .         .         .         .         .         .  g.158912
gtgaactgcccatatgggccttgcctctgtcttccccagcaagaccaatgcgcttccctt  c.7548+840

         .         .         .         .         .         .  g.158972
cgagaggaaggccaaaggtctgctatcttgtcctgagcctttcccatctcctacccaggc  c.7548+900

         .         .         .         .         .         .  g.159032
ccattgcctttctcctccccagtgataacagaatgactcactgggctttttcaggtgagt  c.7548+960

         .         .         .         .         .         .  g.159092
ttccacctccccctctagtccgagttgcctatgggttctcttccctgtgttctcccctcc  c.7548+1020

         .         .         .         .         .         .  g.159152
ccaccttttagtgcttctgctcccatgtgccctggatggaggcaggttttgtttcttctc  c.7548+1080

         .         .      g.159176
cccagggtcaaggtccagctcaga  c.7548+1104

--------------------- middle of intron ---------------------
                        g.159177        .         .           g.159199
                        c.7549-1103  tcaggggctgccccatcctggtg  c.7549-1081

.         .         .         .         .         .           g.159259
gggctgagagctggtccctttgcgctcagtattcctgcccctttccccatctctcatctc  c.7549-1021

.         .         .         .         .         .           g.159319
ccttcaaggcctaccccaccctgcccctcatcagtgtttgcaaagcataaggtgacctgg  c.7549-961

.         .         .         .         .         .           g.159379
gcttctctcctctacctcaagtctccatcttacctaaaagacttgggtgttggcaatggc  c.7549-901

.         .         .         .         .         .           g.159439
tttgctgctgaaccatgtcaggggtcagcggggggtggtggcaatgggtcctcttaatga  c.7549-841

.         .         .         .         .         .           g.159499
gccagtggccaaggctcagtgagtgagtaatcagaggagggagaagtctggagggtggaa  c.7549-781

.         .         .         .         .         .           g.159559
tcaggcctgcagtgggaagatttggccacagggagtcaggagtggggggtgaagagaatg  c.7549-721

.         .         .         .         .         .           g.159619
gctgcaagtgtttggcattttctacacctcatctggaaggagaagaaataagcaggcacc  c.7549-661

.         .         .         .         .         .           g.159679
aggagaagtaggtcagggcctgagatggcggcagagggcacctagttacatatctgggtg  c.7549-601

.         .         .         .         .         .           g.159739
ctggccgacacagagggcactcggagtgacattttctggggaagatcctcctggtgactt  c.7549-541

.         .         .         .         .         .           g.159799
ttctgaaccatggtcttgggccctttcagcttcttgcccgtggtgacaacccttggggtc  c.7549-481

.         .         .         .         .         .           g.159859
aggctacccatgtgcagtcttcgtggacagattgcagggctgcaggggtcccaggccagc  c.7549-421

.         .         .         .         .         .           g.159919
cttcccgggcttctgccagctccctgtctccccttaccatgggaagtggcaccagcctgg  c.7549-361

.         .         .         .         .         .           g.159979
gaaatgggttgagcttcccggctgcaccttcccactgatggcccacagtgctgcttcttg  c.7549-301

.         .         .         .         .         .           g.160039
gccggagtatctgagctcagctcaaaccaatgctgaggaagggagggtgagtcccctggc  c.7549-241

.         .         .         .         .         .           g.160099
ttctccaaggtgcttgcctgggtgcctcagtcaggtgattttgacccaaactgtttgagt  c.7549-181

.         .         .         .         .         .           g.160159
ggtgctcactgagacgagccccactcatcccctccgtgggccctaccctgtggtgggact  c.7549-121

.         .         .         .         .         .           g.160219
tacatgttaagccaggcttcacgtctagaaaccaccttcctgagagaagagcacattccc  c.7549-61

.         .         .         .         .         .           g.160279
aatgggaccctgggctccagccctgccccagcttgttggactaactctggtgccctgcag  c.7549-1


Powered by LOVD v.2.0 Build 28
©2004-2010 Leiden University Medical Center