von Willebrand factor (VWF) - 4401 nt intron 43 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.153620
gtgagtggggcaggggctgggcatgcctgcagctatcagagcgggaaagtagaggagggc  c.7437+60

         .         .         .         .         .         .  g.153680
atcttaggaagggtaagaaaggttcttttttttttgaaatggagactcgctctgtcgccc  c.7437+120

         .         .         .         .         .         .  g.153740
aggctggagtgcagtggcacaatctcggctcactgcaagctctgcctcccgggttcacga  c.7437+180

         .         .         .         .         .         .  g.153800
ggaagggcaagaaaggttctttagtgacctctggttcaaggctaggggtgaggaagaggg  c.7437+240

         .         .         .         .         .         .  g.153860
agggggttagggctgggtaagaagaaaaagcatgagcaaaggatttctgcgtcatccttc  c.7437+300

         .         .         .         .         .         .  g.153920
tgcagttcagtccttggctaatggtcacgtctgttgtatggccttaagtctaaagtactg  c.7437+360

         .         .         .         .         .         .  g.153980
gtggagtaggtttgagcagagacatggggaggactaaatgcctagaaaagagaacttgaa  c.7437+420

         .         .         .         .         .         .  g.154040
gttttcctttttcttccaccctcatgtatcaccttcgcctgtccctagaacaaatgtatg  c.7437+480

         .         .         .         .         .         .  g.154100
ctctgaattttctaggatcgtccttgtttcagtttactctggtgtttccacatagactgt  c.7437+540

         .         .         .         .         .         .  g.154160
tgattttcagaccatgtttataacttgaggtacggaaaacatgatccctgtttcccaaat  c.7437+600

         .         .         .         .         .         .  g.154220
ccagttcgtggtggctgcccctgaggctcctgtgtgtgctggggtgccctattcttgcat  c.7437+660

         .         .         .         .         .         .  g.154280
gtttaggatggatcagactggagaaaaagggagcaacaatctgcagggaggactgtgggt  c.7437+720

         .         .         .         .         .         .  g.154340
aaaattctgcttgctggtttaatgcgattattattactacattattatcagcagataatg  c.7437+780

         .         .         .         .         .         .  g.154400
atgttaagagaagaggtgccagggcaggcgagcacatccatcttgtggttgcttttgcaa  c.7437+840

         .         .         .         .         .         .  g.154460
atgtcaatggcagtgaaggcagagttcctgaaggtgttttcgaggtgaatggtttgacgg  c.7437+900

         .         .         .         .         .         .  g.154520
aggagggcctgagggcaaatcccgaaacccaggcccttcacctgctattctacttgcatt  c.7437+960

         .         .         .         .         .         .  g.154580
tgggtactgagagtgagcggaggtgctcagtacctttgggagaggatgacgctgtggtat  c.7437+1020

         .         .         .         .         .         .  g.154640
ccaggtgttcctgtgggaaacactaagttttggaaaccctttggttttcttctcctctca  c.7437+1080

         .         .         .         .         .         .  g.154700
caggccatctgaggccagggaaataacttgctgtcaaataaagagagtgctgcttagagg  c.7437+1140

         .         .         .         .         .         .  g.154760
tcatttttagaaaattgacaaccaatatatttcgtgtttcagtggggagttttgcttgca  c.7437+1200

         .         .         .         .         .         .  g.154820
aagaatagaacccattcaggctagctacaataaaaggggatttgtagaaaagatacagga  c.7437+1260

         .         .         .         .         .         .  g.154880
ggatctttcagacaggaagtgcaggatttgtaggtgggcaccgtggtcctacagcatgtc  c.7437+1320

         .         .         .         .         .         .  g.154940
tctccatttgtcctaagagccggtatttctgtccgtctgctccagctcctcactgcaggc  c.7437+1380

         .         .         .         .         .         .  g.155000
cagcttcctctgtgcagaagttttgctttctcacacattttgtttacacacagctttgtt  c.7437+1440

         .         .         .         .         .         .  g.155060
aaatctcacttcaactccacacagcttttcagatccgtggttcatccctgtccagtctga  c.7437+1500

         .         .         .         .         .         .  g.155120
cttagttggtctttgtgtttcatggatcaacttctcaagaggaaagttgacaggcccagc  c.7437+1560

         .         .         .         .         .         .  g.155180
tcagcccttggatcgggtccgctgtccagttcatgctctggtccagtcaactattggggg  c.7437+1620

         .         .         .         .         .         .  g.155240
agctgcaggtcctggggtataatcctggctgcgtagaaaagctgggggaagtttcaaaaa  c.7437+1680

         .         .         .         .         .         .  g.155300
gaagatgagtagggaggtcagggcaggagtggaggaggaaccatgtctagaactcttgac  c.7437+1740

         .         .         .         .         .         .  g.155360
cgtgtgattgctctagggaatcgagtgccctgtcttagaggctgaatgttcacatcttct  c.7437+1800

         .         .         .         .         .         .  g.155420
ggggaggagaagggagcctcatggtttaaaatctcaggggacgtgggaggctgggcttcg  c.7437+1860

         .         .         .         .         .         .  g.155480
atctgtactgtgttgagtgaggtgggagcttaagtaagttacagatggtctcagacttca  c.7437+1920

         .         .         .         .         .         .  g.155540
ttctgcaaagagggtagtattgttagcattattagctctggtccgacctcagaggcactt  c.7437+1980

         .         .         .         .         .         .  g.155600
gggctcatatatgccggtccatgtgttgtctaggttgtgacagaaaagaaagaacaacac  c.7437+2040

         .         .         .         .         .         .  g.155660
taccatcatcaccctgaagccacagtctgcagaaacacactttccccaagctcctccata  c.7437+2100

         .         .         .         .         .         .  g.155720
gttctctgctcttcgtgtcagaggaatggtggcaggcaagcaggggcattggcggcttct  c.7437+2160

         .         .         .         .   g.155761
caggaatgttctaagcgggcctcaggcgatggccttgcttc  c.7437+2201

--------------------- middle of intron ---------------------
       g.155762     .         .         .         .           g.155801
       c.7438-2200  catgtccatagtgagaggaggcctgcacctctgtacaagc  c.7438-2161

.         .         .         .         .         .           g.155861
ctttgaggggattttccatgaagcctgatggccatctgactcctcacccgtaggctcctg  c.7438-2101

.         .         .         .         .         .           g.155921
aatgaggctcagtcaaggtgtaggaactgtattctgagaagccaaaggaagtccattaga  c.7438-2041

.         .         .         .         .         .           g.155981
tattatttactctgtgatactcctcaggaagaagaagagggagggctgttcttctcagta  c.7438-1981

.         .         .         .         .         .           g.156041
tcagacaggaaacagggccaccccagggaatggggttggccagaacctctgtagcttata  c.7438-1921

.         .         .         .         .         .           g.156101
tgaagcctgtggacactggagggtcctgacccgagcccagagctcgtcctgttaggctgg  c.7438-1861

.         .         .         .         .         .           g.156161
tacaacccgcaactccagtgttgcaagggccagtctgacccaggaagtcagcttttcaaa  c.7438-1801

.         .         .         .         .         .           g.156221
ctgtgctcctcagattgcctcagaggggacaagtgaccagagcttggcatctaccacctc  c.7438-1741

.         .         .         .         .         .           g.156281
catttcagttatagcaattgtgcttaaaggattgtgctgctagatacattcataatttat  c.7438-1681

.         .         .         .         .         .           g.156341
ttttcagtgcatatgttttcaggttgggtggctagtagacctacttagtttcattcttat  c.7438-1621

.         .         .         .         .         .           g.156401
ttgggaaaccaatgaaaacagggtggagaagagagccaggagaagggcctgggatgtgta  c.7438-1561

.         .         .         .         .         .           g.156461
ttttgatacaagatatcaaatgtcgatataagcgagggaatttgttggaggaagggaaaa  c.7438-1501

.         .         .         .         .         .           g.156521
taaagaattgaaaaatataggttggaccctggttgtgcagccagaaaacagggttgctgt  c.7438-1441

.         .         .         .         .         .           g.156581
ggggtatggaggggaatcttagaaagatggaaatttggagggatggctaaaagtgtctgg  c.7438-1381

.         .         .         .         .         .           g.156641
gtttgagaagctagtggggctgtgggaacagacatctggcctgggagccatccgtaatat  c.7438-1321

.         .         .         .         .         .           g.156701
tgacactgtttgcccatggtgagaggcaacaggaaacaaaaataatatgcgaatctcgat  c.7438-1261

.         .         .         .         .         .           g.156761
cattcagccttctagagaggcgtacgagaatgacagcagatccctaaaggtattaattac  c.7438-1201

.         .         .         .         .         .           g.156821
tgtcttctgtgttctttgagtctttgtttctgaccccctgagaccttgttttttttcttt  c.7438-1141

.         .         .         .         .         .           g.156881
aatggcattttgaatgttctgctgtatcttggagggtgtgtacacagattgaggcatcct  c.7438-1081

.         .         .         .         .         .           g.156941
aatttgttgtctcctccgtagtacctagtacatcataggtgcacagtaaatgactagaat  c.7438-1021

.         .         .         .         .         .           g.157001
cttggctgataaaagcctggagacagctcactgcacactgctgggaggtgggcggtgata  c.7438-961

.         .         .         .         .         .           g.157061
tcagtaggtctcgtggagactgggtggggttgagccaagtctcaggagtgttgagaccgt  c.7438-901

.         .         .         .         .         .           g.157121
ccagagagaggcacacgtgttgtgcatcttcagattcggccctgctggggagagtgcttg  c.7438-841

.         .         .         .         .         .           g.157181
gggagcagagcaggctgccatccacacccgtcctgaacagctgtggttactctttctctc  c.7438-781

.         .         .         .         .         .           g.157241
ttaaggacacagctccaagatggaacgtagtcctgggttcttttctcttggctcctggga  c.7438-721

.         .         .         .         .         .           g.157301
caaacacactgtcattgctttgactattctttctatagacttttcagaggagggtttcag  c.7438-661

.         .         .         .         .         .           g.157361
tccatgttcatgatgctttagccagattggaggaccttctagaggcaagatgggctgaca  c.7438-601

.         .         .         .         .         .           g.157421
aacttccaggatgctggtctccctggcatgctttctggggaagctttgtctgttgctctc  c.7438-541

.         .         .         .         .         .           g.157481
tcatctcacttttcttttgtaaagaacaccgtaccctataaattactaggtaaatgtcaa  c.7438-481

.         .         .         .         .         .           g.157541
gtaacctcttggggaagcccaaatctgcacgttggtgagcagtattgggatcgagtgttc  c.7438-421

.         .         .         .         .         .           g.157601
gtcttgtatgggaggctagccctgcgagagtggagactggatcccagtcatcctgagtgt  c.7438-361

.         .         .         .         .         .           g.157661
gcctcccggtcagtgagggtccctagagttggccatgataagggccagattagtaagctg  c.7438-301

.         .         .         .         .         .           g.157721
ctgctaagggaactctgggctgtctttaatgctcctatggactggatcatggtctctctc  c.7438-241

.         .         .         .         .         .           g.157781
aaagtgggatctttcagggggcagaattatatctctgcagctgatgtaagacttcgttta  c.7438-181

.         .         .         .         .         .           g.157841
gtgacctggtggttgctgcttcttggcatggccctgaggctggttgacaacaaagatgaa  c.7438-121

.         .         .         .         .         .           g.157901
aatgcccagaccagtgatcacttggcacaaccccagggctcagtacgcaggaggcgtagg  c.7438-61

.         .         .         .         .         .           g.157961
taagagcccctgtgtctttgctgctggcctgtccttactctgttttttctgcttttccag  c.7438-1


Powered by LOVD v.2.0 Build 28
©2004-2010 Leiden University Medical Center