von Willebrand factor (VWF) - 1158 nt intron 41 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.146581
gtaaggcctctgtggatgaggaggggtggtgtggcctctctctgctggtgtgagggaggc  c.7081+60

         .         .         .         .         .         .  g.146641
catcctcctcagggacctcttccaagatcacgtcatttcctgttttctacctagctgaat  c.7081+120

         .         .         .         .         .         .  g.146701
ctgggttgggagtacatctggaacagaggggttagggtcacacctgcacggaatccttcc  c.7081+180

         .         .         .         .         .         .  g.146761
ggctgcacgctgctgaaggataccaggtgtgggcacagccacaggcacctccgtcttggg  c.7081+240

         .         .         .         .         .         .  g.146821
tttatgaagaagcagctggggctgagatgaggaggcctccgaatctaatctttatttctg  c.7081+300

         .         .         .         .         .         .  g.146881
cccatcctcctgtatgtcatcaaggggagggaatgtttccttgacttcccctcatcattg  c.7081+360

         .         .         .         .         .         .  g.146941
gatcttattcccaaacaaatttatagttttttgcctctgaaggtgtatatatgtaatcac  c.7081+420

         .         .         .         .         .         .  g.147001
tatatactgtaacttaaacatagcgatggactaaaataagacacgacaagaaaccaaatt  c.7081+480

         .         .         .         .         .         .  g.147061
ctgtatttacctcccgagaatccccactctaactccgttggcgttcttgtcctgctgatg  c.7081+540

         .         .         .           g.147100
tggacactcacccgacttcctagatgtgagacttcaagg  c.7081+579

--------------------- middle of intron ---------------------
         g.147101             .         .         .           g.147139
         c.7082-579  tgggaggagagcacattgtgtttgaagggagctggaaac  c.7082-541

.         .         .         .         .         .           g.147199
aggcaaaggacacagggacaggatttggtcttttaaaagtgacattgtggctttgacaag  c.7082-481

.         .         .         .         .         .           g.147259
attgctggcaatctttcattccacactgattgctggcggacctaaagtgtagggtattgt  c.7082-421

.         .         .         .         .         .           g.147319
tctaggtactgaggtggggataggatcacagaagctcctggcatagaacagtgcttagca  c.7082-361

.         .         .         .         .         .           g.147379
gggcgtggtgtacccagacctactggacttagagattctacatctgacacctctgagaat  c.7082-301

.         .         .         .         .         .           g.147439
gaaggaacccgccccttccagatgtatgtgggaaagtgatagagcagggattgagcagcc  c.7082-241

.         .         .         .         .         .           g.147499
ttcacttctcctccattagagttcctagcttcacatttccctttttgattaatgttcata  c.7082-181

.         .         .         .         .         .           g.147559
tttttctgcagatggactgcttttggtaacattgaataactcccagcccgtgagcttggc  c.7082-121

.         .         .         .         .         .           g.147619
cctcacacatttctgacttaatcttctgagtctaaagctccctggcaccctatagcatag  c.7082-61

.         .         .         .         .         .           g.147679
ctgaatacttacgagccctggctgggcgcagtgctcagtgtggccttgtcctaccctcag  c.7082-1


Powered by LOVD v.2.0 Build 28
©2004-2010 Leiden University Medical Center