von Willebrand factor (VWF) - 1790 nt intron 40 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.144686
gtatgtgtcccaccagggggatgtctccagggcccaaccctagccccagggggcaccacg  c.6976+60

         .         .         .         .         .         .  g.144746
ttgaaggtgctgaaaggtgtctctgttctcaggcacagggtgtgtgaaaggaggtgggta  c.6976+120

         .         .         .         .         .         .  g.144806
aggaccgactggatactccaaaaaagtggaaagggttacctctggagaataggatttgct  c.6976+180

         .         .         .         .         .         .  g.144866
tcctagaagaatctactgtaaattactaaacacaggtttgacaggattaatacaagaatg  c.6976+240

         .         .         .         .         .         .  g.144926
gggtgattactggggactatggagatatactgaagaaaaggtcatgccaaagcaacccat  c.6976+300

         .         .         .         .         .         .  g.144986
tttcattttcaataagattttgaggctgctagatatagagaagaccacacactgggcacc  c.6976+360

         .         .         .         .         .         .  g.145046
ttgagttcagcaggttgtttgctagaggttttcatgctagccttgcaggctgctctgtga  c.6976+420

         .         .         .         .         .         .  g.145106
atagtgggctgaataatggtataagtccgtgaattcagagctgatggaattacggttagc  c.6976+480

         .         .         .         .         .         .  g.145166
atggcaggaaatcattagtgcctttgtcccagtcctgtccagtgtgtttattgcttgtac  c.6976+540

         .         .         .         .         .         .  g.145226
agatgaagacctaaagcacaggcttgtacaatttgcagtgatgcagatattgaagggaga  c.6976+600

         .         .         .         .         .         .  g.145286
gcagatagatcaggggacagtccaaggaactaaaagaaaatcatataatcggagaaactt  c.6976+660

         .         .         .         .         .         .  g.145346
atttgtactcatgaaattgatcagaaataaatagaagtcctgtaggggagggagatgtgg  c.6976+720

         .         .         .         .         .         .  g.145406
cttgagaacaattaatgtaaaggaggtcttagaatgttagcagtagagagaactagaggg  c.6976+780

         .         .         .         .         .         .  g.145466
atcatttacttcaagcccctcattttatagacattactagtctcctacaatgtgccgggc  c.6976+840

         .         .         .         .         .       g.145521
actttgcccttattattttgtgaactcctcagactgatcctataaggtagagttc  c.6976+895

--------------------- middle of intron ---------------------
          .         .         .         .         .           g.145576
     ccaccttccagaagaagaaacaggtctagaggatccaagttgacttggctgagat  c.6977-841

.         .         .         .         .         .           g.145636
gtgaaagccctagtggatgataagaataatcagtatgtgacttggattgatctatctgtc  c.6977-781

.         .         .         .         .         .           g.145696
tgtctgtctgtctgtctatctatctatctatctatctatctatctatctatctatctatc  c.6977-721

.         .         .         .         .         .           g.145756
catctatccatccatcctatgtatttatcatctgtcctatctctatctaacctatgtatc  c.6977-661

.         .         .         .         .         .           g.145816
tatttatcatctatcctgtctctatctatcctatgtatctatcatctatcctatctctat  c.6977-601

.         .         .         .         .         .           g.145876
ctaagctatatatctatttatcatctatcctctatcatctatctatctatctatctatct  c.6977-541

.         .         .         .         .         .           g.145936
ctattgtatctagttatctatcctatatctatgtatgtatctatctgtctgtctaatcta  c.6977-481

.         .         .         .         .         .           g.145996
tctaacctgtgtatctatttataatctatcctatctctatctaacctatgtatctatcat  c.6977-421

.         .         .         .         .         .           g.146056
ctatcctatctctgtctaacatatgtatctatcatctattctatatctatctgtctatct  c.6977-361

.         .         .         .         .         .           g.146116
accctatgttttatcatctatcctatctctctctaagctgtgtatctatcatctatcctc  c.6977-301

.         .         .         .         .         .           g.146176
tatctatcatccatctatctatctatctatctaatgtacctagttatctatcctgtatgt  c.6977-241

.         .         .         .         .         .           g.146236
atgtatgtatgtatgtatctatctatctatcaaatctatctcatgtatctagttatcatt  c.6977-181

.         .         .         .         .         .           g.146296
ctatctatctatctatctatctatctatctatcctaacccatgtaatctctgtctccatc  c.6977-121

.         .         .         .         .         .           g.146356
atcatcacttacctaaaacagtagaagtctgcatgaataggaatgtagcatcccactcac  c.6977-61

.         .         .         .         .         .           g.146416
aggtaataaaagagtaacctttctgaactctgcatggacgtctctctttctggccctcag  c.6977-1


Powered by LOVD v.2.0 Build 28
©2004-2010 Leiden University Medical Center