von Willebrand factor (VWF) - 443 nt intron 39 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.144168
gtgagagtcctcccctccctggtgccttcatggaggaacaagggcccctgcaaggccccc  c.6901+60

         .         .         .         .         .         .  g.144228
cagccacccatcttcacctctggcagagcagactcaaacactggcacctagagtcctaga  c.6901+120

         .         .         .         .         .         .  g.144288
gtgggtgggcttccttgcccagcctgcatttcccatcactgggcctgggagccccattct  c.6901+180

         .         .         .         .    g.144330
gcacctggggtcgacattctcagattaaccctcgcctctggt  c.6901+222

--------------------- middle of intron ---------------------
       g.144331     .         .         .         .           g.144371
       c.6902-221  ccccagcaacggtcagacttaagagtcccctggagggtaaa  c.6902-181

.         .         .         .         .         .           g.144431
tgtgagggtgtcaacaggaacatggggacactcatctgtcagaggtcccgtggcctggat  c.6902-121

.         .         .         .         .         .           g.144491
ccttgtgggatgaccgtacagaactcctactagttttcagtgagcaagaacatttcaaat  c.6902-61

.         .         .         .         .         .           g.144551
ccctctgaggctgtcccaccactaatttctctgacttttgtggccgttcctctcctctag  c.6902-1


Powered by LOVD v.2.0 Build 28
©2004-2010 Leiden University Medical Center