von Willebrand factor (VWF) - 1843 nt intron 37 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.135869
gtgagtctccaagttacctctgaaaatcctggagaccagctaactgggcttgctcagcct  c.6598+60

         .         .         .         .         .         .  g.135929
ctctgtgccccagattctttatctggctaataaggatgaaaatccctgtatttcgtatga  c.6598+120

         .         .         .         .         .         .  g.135989
cctgggattccagttaggatcaaataagatggaagatatatatatacatatacatatatg  c.6598+180

         .         .         .         .         .         .  g.136049
tatatgtgtgtgtgtgtatatatatatatatacacacacacacacacatatatatgtata  c.6598+240

         .         .         .         .         .         .  g.136109
tatatacacacatacactctgcacgtagaatttttatgtaaattaatgcatggtcctttc  c.6598+300

         .         .         .         .         .         .  g.136169
cattagtatttctatagttcagacaaatgcgattttaatgtgttagacacatataggcat  c.6598+360

         .         .         .         .         .         .  g.136229
ctgtaaagggctgtgtaaccagtcacattgaatttgaaattccaccaagctttagcacac  c.6598+420

         .         .         .         .         .         .  g.136289
acttacagtgtagtccatgcctgagcaggattttgaagtgcaagtagaatcattggttgc  c.6598+480

         .         .         .         .         .         .  g.136349
caagagtcttctcagttataaacactgcaggattgctagtgcagacagcccctccccaag  c.6598+540

         .         .         .         .         .         .  g.136409
gtcagcttccctacctggacttggcatttatttaaagtacaggggaaactgaaatgaatc  c.6598+600

         .         .         .         .         .         .  g.136469
agatatggctcctgtccctcaggggtgctggagtgaaaagaatactgaacttgaaaccct  c.6598+660

         .         .         .         .         .         .  g.136529
cagtcatcaaatataatcctcgactatttttttgagggaaatcaatatgtacatgcctgt  c.6598+720

         .         .         .         .         .         .  g.136589
tagagcctcagagtttatcatcatggaactgtcagcagctctgagctgggtctggaggac  c.6598+780

         .         .         .         .         .         .  g.136649
ttgggcatcctagtcccagctcagctggtggatggactgttctcttagtctttctggacc  c.6598+840

         .         .         .         .         .         .  g.136709
tcagtttctgcatcctagaatgagatagttggcctagataacctgtaggttccttagggc  c.6598+900

         .         .    g.136731
tctgattttctgaggccatgtg  c.6598+922

--------------------- middle of intron ---------------------
                           g.136732     .         .           g.136752
                           c.6599-921  gatgatactgcctcctcccaa  c.6599-901

.         .         .         .         .         .           g.136812
tcagcctgcaaatcaaggggcaaatgttagtttctaagttactggaagcactttctctgc  c.6599-841

.         .         .         .         .         .           g.136872
atactgatttctttgtgtacctcctggttatttactgtgcacacagagggaaatctttgg  c.6599-781

.         .         .         .         .         .           g.136932
tgctccaaatccttggaaacttcgtccatcacctgcctgccttggtgccttgaggatgtg  c.6599-721

.         .         .         .         .         .           g.136992
aggaagttgttgagcgaatcagaacgagggaaatgaatcaccttgtagcttctctcccaa  c.6599-661

.         .         .         .         .         .           g.137052
ggcagttctaagctgtgtattcctaatttaaagatgcttttcaagcataaaagacatatg  c.6599-601

.         .         .         .         .         .           g.137112
tattcaaaaaaggacaacaaaacctactaaggacacacaggttcacaacatttgttagga  c.6599-541

.         .         .         .         .         .           g.137172
ctagatttggctgctagtagcagagaattaaaattttctgtcatacaactgatcggaggc  c.6599-481

.         .         .         .         .         .           g.137232
ggtggctccagctgattctgggcctcaaactggattctagttccttgctctgccctcagt  c.6599-421

.         .         .         .         .         .           g.137292
tgggtgtggtctttttcttcatggtctaagatggagttctagccatcacattcatgctcc  c.6599-361

.         .         .         .         .         .           g.137352
aaggaggaagctgagggaaggagggaagagggacaaggagcatgcatagctgtcttttaa  c.6599-301

.         .         .         .         .         .           g.137412
aatggactcctggaagctgccatgggatactatactttcttttacagttcattgggcaga  c.6599-241

.         .         .         .         .         .           g.137472
actagtcatgtgactacacttagctgcaagaaaggttgggaaatatagtcctcattctgg  c.6599-181

.         .         .         .         .         .           g.137532
tggtcatatgcccagcctaaagttctgtttctatggaaggtggggaggatgaagattggt  c.6599-121

.         .         .         .         .         .           g.137592
ggaaaatagccgtctctgccctggcaagtttgtctgatgattaaccatgttgaatcagct  c.6599-61

.         .         .         .         .         .           g.137652
gtgcccatttcactctggctggtgtgggcctttgcaagtgacctccttctctgtctacag  c.6599-1


Powered by LOVD v.2.0 Build 28
©2004-2010 Leiden University Medical Center