von Willebrand factor (VWF) - 211 nt intron 36 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.135316
gtaagaacattttctcaactcctcttctccccctgctatacatttataaaccttacttgc  c.6256+60

         .         .         .         .        g.135362
tctactctgaggctcttggatgcttatatttcagggtctagtagcg  c.6256+106

--------------------- middle of intron ---------------------
   g.135363         .         .         .         .           g.135407
   c.6257-105  agggtcagattctggtgaggatcaagaatggcctgtctctggcat  c.6257-61

.         .         .         .         .         .           g.135467
caatgtttttgtacccagggccactcagtttatcttttttttgtttgtttgtttctctag  c.6257-1


Powered by LOVD v.2.0 Build 28
©2004-2010 Leiden University Medical Center