von Willebrand factor (VWF) - 1394 nt intron 35 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.133729
gtgagaagtactttctgtggatccgtggtaaggcaatagaatgtcaggaaaaccacctgg  c.6063+60

         .         .         .         .         .         .  g.133789
acctggtggcagttgcttttagttgatgctcttgttaggagctctgccttctgcttaagt  c.6063+120

         .         .         .         .         .         .  g.133849
ggaggagaggagtaccactttcttagaggggtttattgccatccccttgtcttggcgtga  c.6063+180

         .         .         .         .         .         .  g.133909
tttcatgttgttccgggctcagatttgcaagatggaatcacttttagatagcataaaatt  c.6063+240

         .         .         .         .         .         .  g.133969
gtgaatttagtgccagtttctggcactggtggagaattgggattggcatcaggattgttc  c.6063+300

         .         .         .         .         .         .  g.134029
actcggaaggtattatgagtccaatgcctaaaccctgtaagctttccaaagggaaacatt  c.6063+360

         .         .         .         .         .         .  g.134089
tatggcctaaattaggtcttttgaaaatatttaaggcctacataaaacgtcaggctccaa  c.6063+420

         .         .         .         .         .         .  g.134149
aatttgaaaagaaaactgcaaaactgatatatatatatataaatgattgattaaatgctt  c.6063+480

         .         .         .         .         .         .  g.134209
acaaaaggttacactatgccaacttctttacttgttcgtgtagaaatcataaatatttca  c.6063+540

         .         .         .         .         .         .  g.134269
ttgtgtgaaaacaacttgtaagctagattttctcacttcgcaagaattcctgaatttgaa  c.6063+600

         .         .         .         .         .         .  g.134329
caataattgcagaaaaatcttagtcatatatcaagtgagtaactcatagccaaaaattaa  c.6063+660

         .         .         .         g.134366
aaaatcaaaatgataaaaaatccttccaaaaatttta  c.6063+697

--------------------- middle of intron ---------------------
           g.134367           .         .         .           g.134403
           c.6064-697  cagcaaaattatattcattgtggaatgtgagtacatt  c.6064-661

.         .         .         .         .         .           g.134463
ttaatgtgtttgatatgatatatggtggggctgcccaagaaagagcgtctagtggcacac  c.6064-601

.         .         .         .         .         .           g.134523
atacacacaaagaagacttaaagtggtcccattaaaacaccagtgtccaaccttttggct  c.6064-541

.         .         .         .         .         .           g.134583
tccctgggccacactggaagaggaattgtcttgggccacacatacaatgcattaacacta  c.6064-481

.         .         .         .         .         .           g.134643
acgatagctgatgagctaaaaaaaaggtctgggcataattttctgatatccaccaccaca  c.6064-421

.         .         .         .         .         .           g.134703
gagaagcaaaaatgtccttgcattcaaagggttggacacagctgctagatgctcttggag  c.6064-361

.         .         .         .         .         .           g.134763
acactgctctgatgagttggcaataaggcgactttcccagcctgtcttaaaggcattgcc  c.6064-301

.         .         .         .         .         .           g.134823
cttccctgttgagtcacatagactcaaggttccttttaatctccaggcttttaggttctt  c.6064-241

.         .         .         .         .         .           g.134883
ggtgcatggccacccgtacagtattacaacagcctgttttctggtcaagctctgtaaagt  c.6064-181

.         .         .         .         .         .           g.134943
caagctctgttttctagtcaagctcttctttatcttagaagagctgccgacaaatatcaa  c.6064-121

.         .         .         .         .         .           g.135003
ggtttgtggctgatgttgcagttgagtgtgatgaatgtgcaggaactctcggtaacttcc  c.6064-61

.         .         .         .         .         .           g.135063
ctaaaaacctaggattcctcattgctaggactacggatgagctctttcttctttgtgcag  c.6064-1


Powered by LOVD v.2.0 Build 28
©2004-2010 Leiden University Medical Center