von Willebrand factor (VWF) - 292 nt intron 33 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.117644
gtaagttcctttctgttgactttgaaagaaaggttagagatgtgtttggggctcttgttc  c.5664+60

         .         .         .         .         .         .  g.117704
ccactggttaatttttcctcctttggtcttagtccagtgcttccttttactattatcttg  c.5664+120

         .         .        g.117730
tttttgcgggtccatctgtacatctt  c.5664+146

--------------------- middle of intron ---------------------
                      g.117731          .         .           g.117756
                      c.5665-146  gtgttttgcttcctgtctcatgtaca  c.5665-121

.         .         .         .         .         .           g.117816
gggggcctccttgctgtgtaggcctgtgttcaattctaggggtcagttgtctggcagatg  c.5665-61

.         .         .         .         .         .           g.117876
ggcttagagttggagtacctcatcttattccctgcctgaatctgctgttttcttctgcag  c.5665-1


Powered by LOVD v.2.0 Build 28
©2004-2010 Leiden University Medical Center