von Willebrand factor (VWF) - 1350 nt intron 32 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.116250
gtgagtcttataatacctttcttacttccctcaaaaaaaagttccaaaataaacccgcca  c.5620+60

         .         .         .         .         .         .  g.116310
aagaaacaaaaatagtattcaagagaccccagggtgcccatgcataagatttggccttga  c.5620+120

         .         .         .         .         .         .  g.116370
atgaagattattatatagaccaggacctttaagtttctgttcatgggaggtgtataccac  c.5620+180

         .         .         .         .         .         .  g.116430
aagcccccatggggccagcagaaagctttctgtgtatggtcctatttccactctaattgt  c.5620+240

         .         .         .         .         .         .  g.116490
ccatgtgaacttggcagagagagcctaagcttatttgtgtagagggatcttggacaaaag  c.5620+300

         .         .         .         .         .         .  g.116550
aatcagaagacataagcaaggaaccccagcgttccgtaggtatagtcttcttccccatgg  c.5620+360

         .         .         .         .         .         .  g.116610
gcctagactaactctcaacatgggtataaagggctttagaaatacgataacacggagact  c.5620+420

         .         .         .         .         .         .  g.116670
catatcaaagtaccatagtttaagttgattttaggttagaaacttaaaaaatatgctttt  c.5620+480

         .         .         .         .         .         .  g.116730
ggccaggtgcagtggctcacgtctgtaatcccagcactttgggaggccgaggcgggcgga  c.5620+540

         .         .         .         .         .         .  g.116790
tcatgaggtcaggagatcgagaccatcttggctaacacagtgaaaccctgtctctactaa  c.5620+600

         .         .         .         .         .         .  g.116850
aaatacaaaaaattagccgggcgtggtggcgggcacctgtagtaccagctacttgggagg  c.5620+660

         .       g.116865
ctgaggcaggagaat  c.5620+675

--------------------- middle of intron ---------------------
                                 g.116866         .           g.116880
                                 c.5621-675  ggtgtgaacccggga  c.5621-661

.         .         .         .         .         .           g.116940
ggcagagcttgcagtgagccgagatcgcgccactgtactccagcctgggcaacagagtga  c.5621-601

.         .         .         .         .         .           g.117000
gactccatctcaaaaaaaaaaaaaaaatacacacacacacacacacacgctttttttgtg  c.5621-541

.         .         .         .         .         .           g.117060
gcgggggcctgggtttgtatattttcccgttactagatgtaagtcaaaacctgcataaag  c.5621-481

.         .         .         .         .         .           g.117120
ctactgtccttcgggggaataagtcaatgcaagtttgcccttaaagggcaataactctat  c.5621-421

.         .         .         .         .         .           g.117180
gcaagttttgacttatagctaataacattagctgtacagagagatggcagctctcctggt  c.5621-361

.         .         .         .         .         .           g.117240
aggaatcttcaagtagatctctttcaggtttccaggatcttgcttcatctccccaccttc  c.5621-301

.         .         .         .         .         .           g.117300
cccatccctggcgtgatctacatgtgaaccaagataatgacagcgtaagctgtagttatt  c.5621-241

.         .         .         .         .         .           g.117360
gccatattatcgctgttgttggcatcataattattaataactgcagagcatgtctgaaga  c.5621-181

.         .         .         .         .         .           g.117420
accacaggatgaccacctcagcctcatgtccctatgtctccactgttaaccttgttcaga  c.5621-121

.         .         .         .         .         .           g.117480
ttcttttcagagttgagttgacttcaaaaactagaccaggttgcttaagcagacattgtg  c.5621-61

.         .         .         .         .         .           g.117540
aatggttcagaatttctgggtgaaagatgggaactaaggtcttatttgtgtctgttgcag  c.5621-1


Powered by LOVD v.2.0 Build 28
©2004-2010 Leiden University Medical Center