von Willebrand factor (VWF) - 2443 nt intron 31 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.113642
gtaagaatctggtgtacagtcctcaattcaggagagcgagacttcagaaatgatagagga  c.5455+60

         .         .         .         .         .         .  g.113702
ttaaaagtgggctggggttacttttggatgttgtggctgatattaaatatgctcaatacc  c.5455+120

         .         .         .         .         .         .  g.113762
aacctctgtcctggtttcaaacagcaggaaattatccaaccacgatgtgattaggaaacc  c.5455+180

         .         .         .         .         .         .  g.113822
aaacaataaaaagtgtgtattgatcctatatctttataactaattataatctttaatttc  c.5455+240

         .         .         .         .         .         .  g.113882
tccacattttccctttgtgtccaggagtgatcatacctctatgccctttctttctaaagt  c.5455+300

         .         .         .         .         .         .  g.113942
aggattcgtggtctcttactaaaatgtcatgtctgaggccagagtgattcattgtagggc  c.5455+360

         .         .         .         .         .         .  g.114002
cttgagaaccaatgggggctttcatgtatttagagtcctttcctggtaccaggtaatggg  c.5455+420

         .         .         .         .         .         .  g.114062
cttggcagggttgatggatgagagacaaaggatcatgctgtaggaaagggaaggatccag  c.5455+480

         .         .         .         .         .         .  g.114122
atgtccagccttgtgctccataagaacatgtgcttatcatgttcttaatatcaacaggat  c.5455+540

         .         .         .         .         .         .  g.114182
gtgagctgggacaggtggtagagtctagggaccacctcccagctgaagaaggtctgggtg  c.5455+600

         .         .         .         .         .         .  g.114242
agtggagtgacattgagtcccctcgtggccacctggagaactgttcatctttcagaaccc  c.5455+660

         .         .         .         .         .         .  g.114302
tgcctaggagtgctgtcagaaccctgtcttttctctgctgtcttcctgatgttcttcctg  c.5455+720

         .         .         .         .         .         .  g.114362
aggaagttatttgctccgttctctatgtcacatatgagctactcaaaatgtgcaaatcgt  c.5455+780

         .         .         .         .         .         .  g.114422
attgtattgtattgtatttgtaacatatctattccttgcaaaaaactgggagttctttga  c.5455+840

         .         .         .         .         .         .  g.114482
aggcaagggaagatcttgcttatttttgtatcatctgtgtatgatgcacaaaataggtga  c.5455+900

         .         .         .         .         .         .  g.114542
ccatttaacgtttgttgagtgaatgaatgtgacatgtttatgaaatctatgattttaggg  c.5455+960

         .         .         .         .         .         .  g.114602
taaaggacactaaaagggaaaggatatatatttggataatataacgaacttacaagagct  c.5455+1020

         .         .         .         .         .         .  g.114662
gaaaagctgctaatagaaaatccgttccaacctgaagcacattgcaaattcctagaactt  c.5455+1080

         .         .         .         .         .         .  g.114722
tctggagagctgaattgaggaatttcaggatggagattttttctccttcagtatcaagaa  c.5455+1140

         .         .         .         .         .         .  g.114782
tccaaagaaagattttcactgggaaagaaagcagttgtggtcttgaagcagatatgatcc  c.5455+1200

         .         .    g.114804
agagcaagtcatttaaccgtcc  c.5455+1222

--------------------- middle of intron ---------------------
                          g.114805      .         .           g.114825
                          c.5456-1221  aaagcctcggtttctcatgtg  c.5456-1201

.         .         .         .         .         .           g.114885
taaatgagcatgcacattctctgggctcagccctgtgatattttctcttctcttcttaca  c.5456-1141

.         .         .         .         .         .           g.114945
tatacccccttggtggtctagttcagtgtcatgggtctaaatacatttatacatctttga  c.5456-1081

.         .         .         .         .         .           g.115005
ctttgaaattcgtatctccagcctcacctcaactcagtttgcatgctctaataggcaaaa  c.5456-1021

.         .         .         .         .         .           g.115065
ctaaactcctgattttcacatctgtctttcttatcttagaaaatggcaattccaaccttc  c.5456-961

.         .         .         .         .         .           g.115125
cagttgttcagttcaaaaagctcagcatccttgattcttcttccttttccctgatacctc  c.5456-901

.         .         .         .         .         .           g.115185
catgcaagccacgaacaaactatagctccatcttcaaaatacttcgagagtcacacctcc  c.5456-841

.         .         .         .         .         .           g.115245
ccacaccatgtccactagggtcacctcaatccgagtccccatcatctctcacctggacta  c.5456-781

.         .         .         .         .         .           g.115305
ttgaaatagctgtctaactggaaccccagcttccacctttgtcccctgcagatcattctc  c.5456-721

.         .         .         .         .         .           g.115365
agcacagcagctgcagtggccctttaatatcaaaatcagctcctgtccctctgctctgta  c.5456-661

.         .         .         .         .         .           g.115425
gtcttggctggctttgtttcattcacagaacatggtgagcccttactgtggccaatggag  c.5456-601

.         .         .         .         .         .           g.115485
cattgcctgatccatgccctttccctctcttgcttgtccctctctccccagcccccggga  c.5456-541

.         .         .         .         .         .           g.115545
gcatgcagtcacatttctgctctggggcctttgcactcactcttctctctgcttgggatg  c.5456-481

.         .         .         .         .         .           g.115605
tccctccctcagacatcctcttggctccttccatccttacatcaggtttctgctcagatg  c.5456-421

.         .         .         .         .         .           g.115665
ccatcttttcaccaaatgcttctccaactgccatatatgcaacgataacccacacctcag  c.5456-361

.         .         .         .         .         .           g.115725
ccctgggcattctcatcccccttatctcattttgtttttttcctaagcatttatccacat  c.5456-301

.         .         .         .         .         .           g.115785
ctgaaattctatatatttactttgtttgtgtgtttgttgtctatctctccatgaggacgg  c.5456-241

.         .         .         .         .         .           g.115845
gggacagggagggactttatgtgcttggttcactgctgtacccctattgcttacaatagt  c.5456-181

.         .         .         .         .         .           g.115905
acctgacacagagtagcagctcattaatatctgttgactgaacatcttcctcatagggct  c.5456-121

.         .         .         .         .         .           g.115965
gatgtatgtgaccagcctggaaaacatgaggctgtattcagatgctggatataacgtcag  c.5456-61

.         .         .         .         .         .           g.116025
gccagtccattttgagccttcttgcccacagatcctttcttgtctctttgctaactctag  c.5456-1


Powered by LOVD v.2.0 Build 28
©2004-2010 Leiden University Medical Center