von Willebrand factor (VWF) - 283 nt intron 30 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.113215
gtaacgttggtgccacaggctggatgcagaagctgcattctggttcttatttttggcata  c.5311+60

         .         .         .         .         .         .  g.113275
agtgactgtgtgacctcggccagtcactttgctccttggccttagtttcttctcctggaa  c.5311+120

         .         .    g.113297
agtgaggggctagatgctcttc  c.5311+142

--------------------- middle of intron ---------------------
                           g.113298     .         .           g.113318
                           c.5312-141  cacgtctctccagatctcaac  c.5312-121

.         .         .         .         .         .           g.113378
tgggtgttccttggagtttctgaatcattcagcttttaagtgacttaaggatccaccgtt  c.5312-61

.         .         .         .         .         .           g.113438
aagacagggtgtcgagccgcagtcagtactgacttggcgtgatctgttctccatcctcag  c.5312-1


Powered by LOVD v.2.0 Build 28
©2004-2010 Leiden University Medical Center