von Willebrand factor (VWF) - 97 nt intron 29 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .           g.112966
gtgggtgagcgaggcacctgaagcagcaggtgacgaagaggctcttttt  c.5170+49

--------------------- middle of intron ---------------------
 g.112967           .         .         .         .           g.113014
 c.5171-48  gtggctctacttgattcaaaataatccgcattttctcgttccgtttag  c.5171-1


Powered by LOVD v.2.0 Build 28
©2004-2010 Leiden University Medical Center