von Willebrand factor (VWF) - 1494 nt intron 28 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.111366
gtatgctggcaccttgtgtgcaggtgggagggctgggcgagggctggcatggccttggtg  c.5053+60

         .         .         .         .         .         .  g.111426
ctacatgcatctgccaagatacgactcgggttctaatcctggcttccctggtctgtgtgg  c.5053+120

         .         .         .         .         .         .  g.111486
ccttggttgaaacttgccttcaaagggcctgtgtttcctcacctccctggcagggagaca  c.5053+180

         .         .         .         .         .         .  g.111546
aactgtgatcctttttcgggggaagatcttttcttattgtgtgtgcttctataaattcaa  c.5053+240

         .         .         .         .         .         .  g.111606
aggtaatggaagcctattgttaacatttaaacaatgccaataaggagtaaaaaaaaaaaa  c.5053+300

         .         .         .         .         .         .  g.111666
aaaatgcaagtcttactttatcacacagcctcttccccacccaattccaccctctgcctt  c.5053+360

         .         .         .         .         .         .  g.111726
caaggtaacctctgttaaaggtggtgatgataagcttcattttgaccacactgggtgggt  c.5053+420

         .         .         .         .         .         .  g.111786
gaaattattccgagtagctgacattcttcagggcaagaccaggatgtcaggtgtcaggta  c.5053+480

         .         .         .         .         .         .  g.111846
gcaggtgcagtcttcagacactggagtcagactgccttagtttgaatcttatctctgcta  c.5053+540

         .         .         .         .         .         .  g.111906
cttgctagctgggtaattttgggcaaatacttaacctctttgtatatcgtctatacaaag  c.5053+600

         .         .         .         .         .         .  g.111966
gatgaggcaaatacttaacctctttgtatatcatctatacaaaggatacacatctttgtg  c.5053+660

         .         .         .         .         .         .  g.112026
tatcctcatctataaaatggggataataatagcacctacttgcttaaaatagtatctggc  c.5053+720

         .         .         g.112053
acatgacaagtgctcaaaaaaaaatgc  c.5053+747

--------------------- middle of intron ---------------------
                     g.112054           .         .           g.112080
                     c.5054-747  ttgctcccactgctgttactactacct  c.5054-721

.         .         .         .         .         .           g.112140
tttactgacactggcgtctaatccattcctagttcctgaacatctttattcggtgtgttt  c.5054-661

.         .         .         .         .         .           g.112200
gggaccatcccagaataataagccttcttttagtatcttttgagtcacacacttgtcagt  c.5054-601

.         .         .         .         .         .           g.112260
acttttgtttctttgtttttgtttttattcacggccatagatttatttaaattcttgtaa  c.5054-541

.         .         .         .         .         .           g.112320
tatttctgctgaggaaaacaacaattacatcatttcatcaaatctcagatgtgctcagac  c.5054-481

.         .         .         .         .         .           g.112380
actaacaggagcactaggcatttatagctggaagaatcacagtatgttcacctgccctgc  c.5054-421

.         .         .         .         .         .           g.112440
aagatctgaggacacagcagctcattgtccagggaggggctgccgctccatttccttttg  c.5054-361

.         .         .         .         .         .           g.112500
cagtctccttgtattgccaggccagtattttactcatttctagaagaatggtggcccctt  c.5054-301

.         .         .         .         .         .           g.112560
cttaccgaggaagcctatgcctgctgcttttatttgtagacatttaaacttcctttgggt  c.5054-241

.         .         .         .         .         .           g.112620
agaattggagtcttctcagtgtctctaaatctgaggtagtccggacccaggaactccatc  c.5054-181

.         .         .         .         .         .           g.112680
tccccatcccctcctccctggcccacattgcccttgtactcacgaaggcaccccccgccc  c.5054-121

.         .         .         .         .         .           g.112740
cccttggtggtgccacgtggtcagcacgccctgcagatcctattggatgtcaggttgtag  c.5054-61

.         .         .         .         .         .           g.112800
gcctggtggccattgtccctgctggcacctgtgtgctcaccttcctggttgtctttgcag  c.5054-1


Powered by LOVD v.2.0 Build 28
©2004-2010 Leiden University Medical Center