von Willebrand factor (VWF) - 2156 nt intron 27 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.107831
gtaaaacagattcctgggttgtttgaagtgatgaatcttattgcttctccaggggccagc  c.3674+60

         .         .         .         .         .         .  g.107891
ttagagactaggttttgggtaaaaagtcctagccacatgagttgagagactgagtttatt  c.3674+120

         .         .         .         .         .         .  g.107951
ttatttgtttatttatttaattcattatttaatgtagtttattgttttgtttgttcctag  c.3674+180

         .         .         .         .         .         .  g.108011
ggtttgcttctttttctttagggatggactagactgcttcctccacatatattcctccac  c.3674+240

         .         .         .         .         .         .  g.108071
agtgtttttgctcttaataggtttttaagtcctaacaggtttttgcttttctcactgaag  c.3674+300

         .         .         .         .         .         .  g.108131
gtgggggtatggtcacttattgtccttgtaggtcatgactagtctgagcacaggtgtcca  c.3674+360

         .         .         .         .         .         .  g.108191
tatactggaggtggggactcaggagaggaaagtgagatggaacccagggccctcaggtaa  c.3674+420

         .         .         .         .         .         .  g.108251
catgaacgtcgtgggggccatagtcaaggtggcagggtgtggctgtcataatggggaggg  c.3674+480

         .         .         .         .         .         .  g.108311
aaggtgctcgttgctctcaccctggcttctcactggacttgcctctgggaaactggcctt  c.3674+540

         .         .         .         .         .         .  g.108371
tggggaggtgagaaggagtcctcagggtgagctctgagccctctgaagtcctgctcataa  c.3674+600

         .         .         .         .         .         .  g.108431
gtagggagcatttattaaaatccagatctattcaacaccactccctgacactaatcaagc  c.3674+660

         .         .         .         .         .         .  g.108491
cttctgggagcttaaacttgagaacgtaaattcgctggggaggggctatggtcacagctg  c.3674+720

         .         .         .         .         .         .  g.108551
ctagagtcagatcctgccgccaccatctgtacaaacaagaatgaacactgcctggggtga  c.3674+780

         .         .         .         .         .         .  g.108611
gttttctagcaaacacaggaaactagaaagtatgtcactcatgcactgttaaccaaggat  c.3674+840

         .         .         .         .         .         .  g.108671
tgaagcaataaatcttgtggatcacgggaaggaggaattaacttcctagtaagactctac  c.3674+900

         .         .         .         .         .         .  g.108731
ctgcgcacactctttatgctgaaacagagactgtagggagcaaaggactgggtgattctg  c.3674+960

         .         .         .         .         .         .  g.108791
atgctggcttggggttctgtgccaaaagggcatgagagcttcgagccctctccccacctc  c.3674+1020

         .         .         .         .         .          g.108849
ctttgctggcacacgggcaggggcagctgccacggtgcacgctgaagctgcaagcagt  c.3674+1078

--------------------- middle of intron ---------------------
          .         .         .         .         .           g.108907
  gtgtggacagaagtcccacagcaggctggtggcatcacctggtatcaagccgcagggg  c.3675-1021

.         .         .         .         .         .           g.108967
gacacttcccaggctcagggcgctgccgccttgtcagctttactgggagtgctgaaggcc  c.3675-961

.         .         .         .         .         .           g.109027
aggtgcctccaaggctgagagtccaaagaggagatggtcctggcccatattggtctccac  c.3675-901

.         .         .         .         .         .           g.109087
cacacggtcacttgatttcacctgtgggctggcaggccgtgccactttccgggacactgg  c.3675-841

.         .         .         .         .         .           g.109147
caaaaaggtgatgttaccagcagagcctggaaatttggcatggtagtgtaggaatttgtg  c.3675-781

.         .         .         .         .         .           g.109207
tgtggggggccactgctctactacagacttgtggtgtgtgcttggggctgggcacagagc  c.3675-721

.         .         .         .         .         .           g.109267
ctggccagtacctggcacatgagaggtgctcaccctatgtctgctggaggaatgagtgaa  c.3675-661

.         .         .         .         .         .           g.109327
tgtcttttcctaggcctgacaccgtggagacccctgtctgctactcccaaataatttgtt  c.3675-601

.         .         .         .         .         .           g.109387
ctgctagataaagctggggttttgaatctttattcatctttctacaatgtttttgctcca  c.3675-541

.         .         .         .         .         .           g.109447
attttttctctcttcgttagggcccaacatatcaaacatgttttaaaactcatgcaattt  c.3675-481

.         .         .         .         .         .           g.109507
acattctgttagaatatgtactgtaaagcatttatcttcaacagaacatgtacaaacaca  c.3675-421

.         .         .         .         .         .           g.109567
ggttagcgtctacattttagtaacatttgttcttggagacacttgtaagaaggcttggat  c.3675-361

.         .         .         .         .         .           g.109627
tataattaagtattcatgttgctaaagatgtaggttgaaaagaaatcagctttgagtggt  c.3675-301

.         .         .         .         .         .           g.109687
tgtgtggatggcctagaacaacgagtatattttttcatatcctaggatgggctaaagctt  c.3675-241

.         .         .         .         .         .           g.109747
tggtttctagaatcaaaggaagtcggctatgtgtgtgttttgaaggtggggggcatgcta  c.3675-181

.         .         .         .         .         .           g.109807
tttggggacagatgttaaacaatgacatctcacttggatgtggaatggtccatgggatct  c.3675-121

.         .         .         .         .         .           g.109867
caagttcaggtggaacagaggagattctgtgggaatatggaagtcattgtacactgtagg  c.3675-61

.         .         .         .         .         .           g.109927
gctcagaagtgtccacaggttcttcctgaaccattttaatttcttcgctcttttctgcag  c.3675-1


Powered by LOVD v.2.0 Build 28
©2004-2010 Leiden University Medical Center