von Willebrand factor (VWF) - 704 nt intron 26 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.106991
gtgaggcctctatccctgggggtcaggctggtgggatgggatagggatggatggaaaggt  c.3538+60

         .         .         .         .         .         .  g.107051
gcttctaggtcttgcttcatctcagcctccacctgccacgtcctatctctgacctgcaag  c.3538+120

         .         .         .         .         .         .  g.107111
gctgctgcaggttccgtgggttctttcatcagagtcaggacagtcgtgatttttctcaag  c.3538+180

         .         .         .         .         .         .  g.107171
tcgagctcctccaaaatgcttttctgtgcctatttatgggattctcacctaaagcagccc  c.3538+240

         .         .         .         .         .         .  g.107231
ctgccgatagaactttctgcagtgggggaatgttgtattgaatgtaactgtgacgagtgt  c.3538+300

         .         .         .         .         .    g.107283
gtctgaggaactgaagttttgaattttattgaattttacttaatttaacgta  c.3538+352

--------------------- middle of intron ---------------------
          .         .         .         .         .           g.107335
        aatagccacacgcagtttgtgacgatcctatggtacagcacagctctagagt  c.3539-301

.         .         .         .         .         .           g.107395
tactgaaggtgttattcagaagagcagaaagagccccggagataagatttcatttgtcct  c.3539-241

.         .         .         .         .         .           g.107455
gaggcttggggaggtgaggtagggtgaaggaatccccgctcccagttttgcagagggatc  c.3539-181

.         .         .         .         .         .           g.107515
aatcaaggcacaagcaggagagatgctccttgagtgatggggtgacccctgggagtgcag  c.3539-121

.         .         .         .         .         .           g.107575
gcaggaggagttggcttctagggcaggaggaggagttggctcctcccttttagttaaaaa  c.3539-61

.         .         .         .         .         .           g.107635
tgaggcttcctcgtgggaaaggggagcgttttggttcctaatgagagctttcttttgcag  c.3539-1


Powered by LOVD v.2.0 Build 28
©2004-2010 Leiden University Medical Center