von Willebrand factor (VWF) - 732 nt intron 25 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.106100
gtgagtactgacgccctcatgttctcagatgccctcccttcttcccatgtgtctatgctt  c.3379+60

         .         .         .         .         .         .  g.106160
gaagaccttgtgagtgcagggggatatcttcatgggcgagagaagacagagtgttagtag  c.3379+120

         .         .         .         .         .         .  g.106220
ggactggatggccaagggctaaggagggttaagacattggctgtgtaagaagtttatatt  c.3379+180

         .         .         .         .         .         .  g.106280
acgggtgaggtgggacatggattcaaggcatgaacatgtggagacttttcttctggagag  c.3379+240

         .         .         .         .         .         .  g.106340
attctggcaggggagaagagggaatactgatgaaaagaaggaagtcgatttatgtcttta  c.3379+300

         .         .         .         .         .         .  g.106400
attaggcgtgattatatttgccaatatgagtgatcaactcatacattcatgtctatagaa  c.3379+360

        g.106406
tcttgc  c.3379+366

--------------------- middle of intron ---------------------
                                          g.106407            g.106412
                                          c.3380-366  ttcttt  c.3380-361

.         .         .         .         .         .           g.106472
ggacagaagcaacttaatgtttttatgtagaaaactgggccgggcacagtgactcatacc  c.3380-301

.         .         .         .         .         .           g.106532
tgtaatccctgtgttttgggaggctgaggccagaggattccttgagcccaggagttcaag  c.3380-241

.         .         .         .         .         .           g.106592
accagcctgggcaacatagcaagaccccatctgtacaaaaattaaaaaaagaaatgaatt  c.3380-181

.         .         .         .         .         .           g.106652
cagaaccaatagattctggtttaggtgcttcaacaatccagaagtctctaatattggtga  c.3380-121

.         .         .         .         .         .           g.106712
cgcccatagtcccctagttccccaacattatctccagatggcgcaggccatcaccacatg  c.3380-61

.         .         .         .         .         .           g.106772
ggtctgcagtcctggaggctttgcctgttgtggccacagccttgtctcctgtctacacag  c.3380-1


Powered by LOVD v.2.0 Build 28
©2004-2010 Leiden University Medical Center