von Willebrand factor (VWF) - 212 nt intron 23 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.103825
gtacgtctgggtctctgtgtggacagagccctagagcttgcttcctggaatgtccctctg  c.3108+60

         .         .         .         .        g.103871
tccccattgtcatgggggctggaaggggggttgtgggtggtatgac  c.3108+106

--------------------- middle of intron ---------------------
  g.103872          .         .         .         .           g.103917
  c.3109-106  ctccaggtggctgcagggtgggaaggagggtctcttggatccttct  c.3109-61

.         .         .         .         .         .           g.103977
gggctgaataaccccagtttgaccagctgacggctggcctatctcttgcctggttcccag  c.3109-1


Powered by LOVD v.2.0 Build 28
©2004-2010 Leiden University Medical Center