von Willebrand factor (VWF) - 1955 nt intron 21 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.98287
gtaagtgcagcctcatctccaccctcatgtcccgctttgtgcttctgccacttaatagga  c.2820+60

         .         .         .         .         .         .  g.98347
acattttccaagcattcatttagagctcgtgtgaatggaataacgcacagccattaaaga  c.2820+120

         .         .         .         .         .         .  g.98407
ggatgaggcagagctattgcaactgaccgtgacgtattattttatgagaagaacaagtgg  c.2820+180

         .         .         .         .         .         .  g.98467
cagaacaatagggatgacacaatcccattttagcgacagtgcagagtgtgtgtgaaggat  c.2820+240

         .         .         .         .         .         .  g.98527
gtgcacatgtgtctgcacaaacgtgggaagaaccagtgctcacctctagagtagggtggg  c.2820+300

         .         .         .         .         .         .  g.98587
gactggagggtagccgggtttctttgtgtgtgtgtgtgtgtatgaagtgatgatgttatg  c.2820+360

         .         .         .         .         .         .  g.98647
ggatatgtttcatatgtttttctgttcttttcagataaatactttatttttttgagatgg  c.2820+420

         .         .         .         .         .         .  g.98707
agtctcgctcttttgcctaggctggagtgtagtggtgtgatctctctgctcactgcaacc  c.2820+480

         .         .         .         .         .         .  g.98767
tccacctctagggttcaaacgattctcctgcatcagcctccttagtagctgggactacag  c.2820+540

         .         .         .         .         .         .  g.98827
gtgtacaccaccgtgcccggctaatttcttgtatttttagtagagataggatttcgccat  c.2820+600

         .         .         .         .         .         .  g.98887
gttggccaggctggtctcgaactccagaccccaggtgatctacctgccttggcctcccaa  c.2820+660

         .         .         .         .         .         .  g.98947
agtgctgagattacaggcatgagccaccatgcctggccagaaaggagctcaaaagaggag  c.2820+720

         .         .         .         .         .         .  g.99007
taaactaattcagtcccctgtgtactaagaacttaaaaagtagttctcataagtgtacac  c.2820+780

         .         .         .         .         .         .  g.99067
aagactcccttaggagatcttgtttaaaatgtggctcctagaactccatgctgagattct  c.2820+840

         .         .         .         .         .         .  g.99127
gactcagtaggtctgggtggggcccaggaacctgtgtttaaagttgcaggtcatccccag  c.2820+900

         .         .         .         .         .         .  g.99187
gccacagttttggatccgctgctttgactatgtggagtgctgtggagacccaggctctgg  c.2820+960

         .          g.99205
gcacaaacttgtcctggt  c.2820+978

--------------------- middle of intron ---------------------
                               g.99206            .           g.99222
                               c.2821-977  atcttcattttctccca  c.2821-961

.         .         .         .         .         .           g.99282
tggcctcagcctgcagctctgccttcttccaaatacccaccattgacagcaggggatggg  c.2821-901

.         .         .         .         .         .           g.99342
aggtgaattcttcaccattatggaagaaaactgcttagcaagcataacgtattaactgtg  c.2821-841

.         .         .         .         .         .           g.99402
agtcagcagtgtcaactgcatttcaaagaacagctctatttagggcagagtggcggtgat  c.2821-781

.         .         .         .         .         .           g.99462
gatgctgaacaggaggtgtgcagacatgtgagggatagatttgcacatgtgattagctct  c.2821-721

.         .         .         .         .         .           g.99522
gcactgcatgtgatatgttactaatgagaggacctctgcaaagggatgatggcagttctc  c.2821-661

.         .         .         .         .         .           g.99582
agcctcagcctcagtctgatgaattggagagtccgccacacatgctgaaatggtcctcca  c.2821-601

.         .         .         .         .         .           g.99642
gggtacagcactggcagggattgggctaagtcagaggctcaggtcagagcccttcttgaa  c.2821-541

.         .         .         .         .         .           g.99702
cctgcagtgtgtgattcccagcactagcactgagcacctcagtttcctttttcttcagct  c.2821-481

.         .         .         .         .         .           g.99762
ctgtctcctgatgacagtggctctggggagggggaggtggtgggatacaagaaaggtgag  c.2821-421

.         .         .         .         .         .           g.99822
agtctactgcttatttttatagaggaatagatttttaaacaatcaactagagatgcttaa  c.2821-361

.         .         .         .         .         .           g.99882
aatcattgccatgttgaaaacctatctaggagaccactatatttaatgactaattgtcaa  c.2821-301

.         .         .         .         .         .           g.99942
taaaatacctgctcattggtttcatagtactttaatttcataatcatgattttgctgcta  c.2821-241

.         .         .         .         .         .           g.100002
cctctgttaccgtctcttggtcatggatgcctggagagtggtggtggtgagatggtcaca  c.2821-181

.         .         .         .         .         .           g.100062
gacatgtcctggcgtggggctggccctgcaggggtgcagtggcaggtggggtcctggagg  c.2821-121

.         .         .         .         .         .           g.100122
ggtggcagtgcctgcactcgtgggcactgaagacagatgggcaggtgtagagtggaggga  c.2821-61

.         .         .         .         .         .           g.100182
ggatctggctgtcgagcctgcccttcatcctcctggatttcttgctttgtcttcctccag  c.2821-1


Powered by LOVD v.2.0 Build 28
©2004-2010 Leiden University Medical Center