von Willebrand factor (VWF) - 3109 nt intron 20 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.95043
gtgagaggtggggagatggggagagggtgctgtttctttctaggaggggtgggaggtgtg  c.2685+60

         .         .         .         .         .         .  g.95103
gcctcaggttgggttctgtggatctgtctgcagaaacaactctggggtctggtttctact  c.2685+120

         .         .         .         .         .         .  g.95163
ggagtacttcccagtccttcacagaagtgcctgaagcggtaggggatttgaagctcaaag  c.2685+180

         .         .         .         .         .         .  g.95223
tggttgtccattttccctctgctcacctggggacttataaaacgagacagaagcttgttt  c.2685+240

         .         .         .         .         .         .  g.95283
gttgttgaggattggtgtgggagaaaggctactgctagtccacattagcacagatgtgga  c.2685+300

         .         .         .         .         .         .  g.95343
attagaaaaagtcatctgttccttctggtagacacagcctcagtcagggtgcatagctta  c.2685+360

         .         .         .         .         .         .  g.95403
gggagtgggttgggctgggaagtcagtcccgctcagcctcccttccagcaccctgggcag  c.2685+420

         .         .         .         .         .         .  g.95463
tgcacagtctgcaggtgttgtgcagtggccctggacagggggatggttgaaatgacccct  c.2685+480

         .         .         .         .         .         .  g.95523
ggagtttgcttcccacgatatggctttgtggaattctccgccattttaatgtctaacttg  c.2685+540

         .         .         .         .         .         .  g.95583
gtacaattcagaatgggaggagtgggaggatgggacacaggaaagtcatcctgcccagca  c.2685+600

         .         .         .         .         .         .  g.95643
gatgagagcgatccaggaatcctcacggtgagtgtgggcagcagcccctctgcctcccac  c.2685+660

         .         .         .         .         .         .  g.95703
tccccactgcgtggattcttgtaagtttctctttctggttgacatcaactgtgtaagcaa  c.2685+720

         .         .         .         .         .         .  g.95763
ggaagtatgagtgcttttctcaccagagctgaggcactgtactctgtgaagctttgaaca  c.2685+780

         .         .         .         .         .         .  g.95823
aatatggtccctctgtctccattcccaggaggaggaggggcgggagcttggtgtggtctg  c.2685+840

         .         .         .         .         .         .  g.95883
aatggaagaccacaaacccataggagccccagccccagaggctgagttgcaggagctggt  c.2685+900

         .         .         .         .         .         .  g.95943
gagtcaggcagcgtgggtgactgtggaccgaccactcgtgtagagcatgctgggcatggg  c.2685+960

         .         .         .         .         .         .  g.96003
gcggagccaacagcagcctcctcagtccccacctcacacccgggctggcccagagaggca  c.2685+1020

         .         .         .         .         .         .  g.96063
ggcagtgtgctggggacacagggcatgcagaccaggcagggaacctatgatccgggggga  c.2685+1080

         .         .         .         .         .         .  g.96123
tatgcgcccctttagagctttcccagagattctatatggaagtttcccagcctcagcagc  c.2685+1140

         .         .         .         .         .         .  g.96183
aaaagagagggcgacaccagctttgcagaacaactgcccagcccatttcaaatctgaaca  c.2685+1200

         .         .         .         .         .         .  g.96243
tccaggaaaaaattaattcagtgcagcaaggaccagacagctggtcagcatctgctgctc  c.2685+1260

         .         .         .         .         .         .  g.96303
ccagcccttccctgcccaggccagctttcccaagtggaccagttttaaagactccccctc  c.2685+1320

         .         .         .         .         .         .  g.96363
caaacggtgccccttgtgtgtggcttgttttcctttcctacagctggttctgttgtcttc  c.2685+1380

         .         .         .         .         .         .  g.96423
tgatgcattgtcctggggcccctcccctttctgccatcctcctttggggagtatcatcaa  c.2685+1440

         .         .         .         .         .         .  g.96483
gacctaactccctctttcagaaatctcagctgaagataaggacaaataaaacacctacac  c.2685+1500

         .         .         .         .         .       g.96538
ccttgtttcctcttttaaccttcgccatgcatcgacctaacacaaagccatttaa  c.2685+1555

--------------------- middle of intron ---------------------
          .         .         .         .         .           g.96592
      cctgacaattccattaagttgaatggaatcttagaggtcagattgtgtgtgttg  c.2686-1501

.         .         .         .         .         .           g.96652
tatggacatatgtatgcatgtatgtgtgcatgtgtgtatgcatgagcatgtctgtgtggg  c.2686-1441

.         .         .         .         .         .           g.96712
tgtatgcatgtgcgtgtgtgtgggtgtatgcatgtgcgtgtgtgtgactgtgtatgagta  c.2686-1381

.         .         .         .         .         .           g.96772
catgggtgtatgtgtgtgtatgcgtgagcgcgtgtgtgtgtatggctacgtgtgtgtatg  c.2686-1321

.         .         .         .         .         .           g.96832
tatgtgtatgcgtgtgtgtgtgtatgagtacatgggtgtatgtgtgtgcatctgtgtatg  c.2686-1261

.         .         .         .         .         .           g.96892
tgtgagcacgtgtgtgagtgtgtgtatgagtacatagatgtatgtatatgtgtgtttgag  c.2686-1201

.         .         .         .         .         .           g.96952
tgtatgcatgtgcctgtgtgtatttgggtgtatgtgtgtgtgtgggtgtgtgtgtcagaa  c.2686-1141

.         .         .         .         .         .           g.97012
aggtaagtggtttgctcagtgttaccaataagtggcagaatcaagattcacaccttgttt  c.2686-1081

.         .         .         .         .         .           g.97072
ttattttttctttttttttttgagacagagtctcgctctgtcacccaggctggagtgcag  c.2686-1021

.         .         .         .         .         .           g.97132
tggtgcgatctcggctcactgcaagctccgcctcctcgattcatgccattctcctgcctc  c.2686-961

.         .         .         .         .         .           g.97192
ggcctccctagtagctgggactacaggcgcccgccaccacgcccggctaattttttgtat  c.2686-901

.         .         .         .         .         .           g.97252
tttagtagagacggggtttcaccgtgttaaccaggctggtctcgatctcctgacctcgtg  c.2686-841

.         .         .         .         .         .           g.97312
atccgcccgcctcagcctcccaaagtgctgggattacaggcgtgggccaccatgcccggc  c.2686-781

.         .         .         .         .         .           g.97372
ctcttttttcttttcttttcttttttttttttgagatggagtctcgctctgtcaccaggc  c.2686-721

.         .         .         .         .         .           g.97432
tggagtgcagtggtgcgatctcggctcactgcagcctccgcctcccgggttcaagcgaca  c.2686-661

.         .         .         .         .         .           g.97492
cactctgtttttctaagttgaacattttatctttctttttcatcacatcacaataatagc  c.2686-601

.         .         .         .         .         .           g.97552
caccatgggggaggcatttgccaggaatgtgtccccttttgcttaattttctatgcaatt  c.2686-541

.         .         .         .         .         .           g.97612
gaccaacaaggaccagagctccttatcctctctactcatctcgacttggtagctcaggac  c.2686-481

.         .         .         .         .         .           g.97672
ccatggagctgtgtcaaaccatctttggttccatttctgggccagcagtgcagagggatt  c.2686-421

.         .         .         .         .         .           g.97732
caaccagaattcagagccacaaagtgccctgtggtcaaactgtcccagttacctgggtgg  c.2686-361

.         .         .         .         .         .           g.97792
gactctaggcaaggctccagtgggactctaatgggctctaggcaaggcctttgagcctga  c.2686-301

.         .         .         .         .         .           g.97852
tgcatccatcgaagcaggccacatgtcaccttccttccctccccctccttccccaccccc  c.2686-241

.         .         .         .         .         .           g.97912
accccactcactgcaggcacctggctcatctgtcgtgggcgaggttgacacacctgaggg  c.2686-181

.         .         .         .         .         .           g.97972
cattcacctgggcatatcccccgtcccccagacacacacagaggcacatatgcgcagcca  c.2686-121

.         .         .         .         .         .           g.98032
tggacgtggcaagatcctgtgacacgtactcaaaggcctgtgatgaagagatgccaatct  c.2686-61

.         .         .         .         .         .           g.98092
tctggtctggtgagagccagtggggataatggtcttctcctggcactcctctttccccag  c.2686-1


Powered by LOVD v.2.0 Build 28
©2004-2010 Leiden University Medical Center