von Willebrand factor (VWF) - 1561 nt intron 19 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.93343
gtgaggctcagtgaggggctgcgccggggacccaggccctgcgggtggagtgagggtgca  c.2546+60

         .         .         .         .         .         .  g.93403
cgcggccacaggaccttccgcacttgcctccagccccctgtgggaacctggttactctct  c.2546+120

         .         .         .         .         .         .  g.93463
gcctttcctccgtgcctgtgtttctccatctgtaaaatggggagaatctttttcatcacc  c.2546+180

         .         .         .         .         .         .  g.93523
tgtgtccatcctgcatagacactattcaacaggttagtacagtagcccttatccgaaatg  c.2546+240

         .         .         .         .         .         .  g.93583
cttgggaccacaactgttttggattttggattattttggactttgaaatatttgcatata  c.2546+300

         .         .         .         .         .         .  g.93643
cataatgaggtgtcttagggatgggacctaaatctaaacatgacatttatttatggttca  c.2546+360

         .         .         .         .         .         .  g.93703
tatataccttatacacgttgcctgagggtaagtttatacaacattttaaatatgtattta  c.2546+420

         .         .         .         .         .         .  g.93763
atgtgtatttagtatttttaatgtttgtgcatgaaacaaagttttgtgtacattgaacca  c.2546+480

         .         .         .         .         .         .  g.93823
tcagaaagtaaaggtgtcaccctctcagccacccatgtggtgtcatgttggtgctcaaag  c.2546+540

         .         .         .         .         .         .  g.93883
ttttgggtttcagaacattttggacttcagagttttggattaggaatgctcagcttgtat  c.2546+600

         .         .         .         .         .         .  g.93943
ttctgttcagggagatgggccccagggaagacagggacctcgccccaccagtcattgcat  c.2546+660

         .         .         .         .         .         .  g.94003
ttgggccaagctgccagtgggcacggggtctggagggtcctttcgttgcaggccttacac  c.2546+720

         .         .         .         .         .         .  g.94063
tgcccatgagcacttcgtgagtgtgcttgcagtggcgtggtttgaggtgagggtggctgg  c.2546+780

   g.94064
t  c.2546+781

--------------------- middle of intron ---------------------
.         .         .         .         .         .           g.94124
tgccttctcccttttccttggccatcctgcacgtaacccctcaccctgctcattcaccct  c.2547-721

.         .         .         .         .         .           g.94184
gcctttgacttggtggctgtgcacagccttggaaagaggcctactggacagaggtagaga  c.2547-661

.         .         .         .         .         .           g.94244
gggctgtctcttgggcttgaggtctgagcttaccacctctgacgcacaagtgggcttctt  c.2547-601

.         .         .         .         .         .           g.94304
gatgtcagctctggttacgggtggtggcagggagggacacgtggcagtgggcagatcact  c.2547-541

.         .         .         .         .         .           g.94364
atagattttaacatgtagctacatacatcttaacgtgtagctatgcacacaggactgctc  c.2547-481

.         .         .         .         .         .           g.94424
ctggcagaagtgcgtacttcatcactcttttctatactctgggctttcccactgttctgt  c.2547-421

.         .         .         .         .         .           g.94484
cttgtttttcccattagcctcaggctttcaacatcagtgtgtctgttttacagacaccct  c.2547-361

.         .         .         .         .         .           g.94544
gtggccaatctcaggtagatgtggctttcagggtgaggctgagcgaattcataacaggag  c.2547-301

.         .         .         .         .         .           g.94604
gcctaaagagcatccgggcctcctccctggctgcctggctcactttggacaaccccttcc  c.2547-241

.         .         .         .         .         .           g.94664
cttctttgcctcagtttcccccttttagggacagccactaggcttccctgtctcctgctg  c.2547-181

.         .         .         .         .         .           g.94724
ggcaccatactgggcctatgaagtccacactccacgctacaggtcctcaacttccttggg  c.2547-121

.         .         .         .         .         .           g.94784
cttcctggagggttgggaggcacccagagtattctgtgttccttcattgcctccatggcc  c.2547-61

.         .         .         .         .         .           g.94844
cagatgggcccctcaaacccaaggtgcccaacttgtcatctctgccatgactgctcctag  c.2547-1


Powered by LOVD v.2.0 Build 28
©2004-2010 Leiden University Medical Center