von Willebrand factor (VWF) - 2271 nt intron 17 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.83008
gtgagtactgtccccctggaaggcccattgactccatcctgcccagattcctcacgtgtg  c.2281+60

         .         .         .         .         .         .  g.83068
gaatggcgggagagagctgggtgacaccgtcagatgtgcgtgtgcacccaggcatgggtc  c.2281+120

         .         .         .         .         .         .  g.83128
tggcttcgcccaggatcgccttcatttctgggtttgtgtgagtgactttcaggccaaggc  c.2281+180

         .         .         .         .         .         .  g.83188
atgtctttgcatgtgtcaatcccgaccattgaggcaaggagtatttgatttcgtgtaagg  c.2281+240

         .         .         .         .         .         .  g.83248
ggaaagacctgcagataaattctatgagacccctattttgcccgtggagaccttaaccca  c.2281+300

         .         .         .         .         .         .  g.83308
gtggatagctgtgagttggtggccttgattgtgatgacagtcacccttctttgatggcct  c.2281+360

         .         .         .         .         .         .  g.83368
cttgtttcctatggacatgctgatgaagacagctcttccttgagaaagcttcttggatgg  c.2281+420

         .         .         .         .         .         .  g.83428
gtttgaaagagagaaagagaagggttgggtccgttgctctccattcgaaggtcctaacgg  c.2281+480

         .         .         .         .         .         .  g.83488
tggctgcactgtcttttttttttgagagtctcactctgtcacccaggttggagtgcagtg  c.2281+540

         .         .         .         .         .         .  g.83548
gtgcaatctcagctcactgcaacctctgcctcctgggttcaagcaattctcgtgcctcag  c.2281+600

         .         .         .         .         .         .  g.83608
cctcccaagtagctggaattacaggcatgcgccaccacacctggctaattttttgtattt  c.2281+660

         .         .         .         .         .         .  g.83668
ttagtagagacggggttttgccatgttggccaggctggtcttgaactcctgacctcaagt  c.2281+720

         .         .         .         .         .         .  g.83728
gatctgcctgcctcggcctcccaaagtgctgggattacaggcatgagccaccacgcctgg  c.2281+780

         .         .         .         .         .         .  g.83788
cctgttgtactgtttaaggaccaggcatggaagggagaaggggctgacctggtactgggg  c.2281+840

         .         .         .         .         .         .  g.83848
gtttcacatttacatttatggattgcagcacccttatttgcttccagaaggcttatcctt  c.2281+900

         .         .         .         .         .         .  g.83908
gcttagaaaggactcttccagtgggagagagataaatggctatcttcaatctccagcttg  c.2281+960

         .         .         .         .         .         .  g.83968
actgcttccctctctgcctctcactttccacaaggctccttctgtccaagggacccagtt  c.2281+1020

         .         .         .         .         .         .  g.84028
ctgtgccatggtgtttgcttcctggcttgccctgcgtgacaggtctggctcctggcgtga  c.2281+1080

         .         .         .         .         .        g.84084
ccgactggagagcgtctctcagcctagagctggggcaagatcccgagggcatgggt  c.2281+1136

--------------------- middle of intron ---------------------
          .         .         .         .         .           g.84139
     ggctcaaaggttgagaccagaacttgtgacctcaagatcactccatccttctgtg  c.2282-1081

.         .         .         .         .         .           g.84199
tcttcttctgtccctctcagagagttttccccacacccactctctgttgcattctgcctc  c.2282-1021

.         .         .         .         .         .           g.84259
tcagacctaccttccgtgcttctgctcagaatcttctagtctggtcactggaaaatgtaa  c.2282-961

.         .         .         .         .         .           g.84319
tatttttcaaagtcaggaaactcctgggattctgtgcagattgggaaaagccgtttagcc  c.2282-901

.         .         .         .         .         .           g.84379
ttttggagtttcagttttctaacaagagtttccatataaaaataaggctagaaattttga  c.2282-841

.         .         .         .         .         .           g.84439
ctgttttgcccagaggagcgagtatgtgatacaaatgctattaagtgcacctgggctttg  c.2282-781

.         .         .         .         .         .           g.84499
gaaagaaaggtgctgtatcagtcatctgctgtcagtattacccaattagccattgatacc  c.2282-721

.         .         .         .         .         .           g.84559
tactaattgccacgaagtaggatatgtcaatgcgcaaagtagatagaaatccctggcttc  c.2282-661

.         .         .         .         .         .           g.84619
atggaacatgcgttctagtgggcccagtggcttggggaggacagtaaacaagtaagtgag  c.2282-601

.         .         .         .         .         .           g.84679
atgtgtagtatatcagatggtgagaagaacatatataggatatcagaggggaagcagcag  c.2282-541

.         .         .         .         .         .           g.84739
ggaggggagattggagtgtccagggatggagtgttgcgggtgttgcaaattcgcatggag  c.2282-481

.         .         .         .         .         .           g.84799
tggctgggcaggggctgacgcgagcagagatctcttttaaagccattgtggtcagatggc  c.2282-421

.         .         .         .         .         .           g.84859
cttctctccccacattagttgtaaccatttaggaatgattctgttgggtccattaaaact  c.2282-361

.         .         .         .         .         .           g.84919
cctttttagcacccaaactcaggtcttttcaagcctgggtctggaaatttctgcaatgca  c.2282-301

.         .         .         .         .         .           g.84979
tcctgattcaatgtaacctgctatagcaaggttaagggtgatgacaagtatgggacatta  c.2282-241

.         .         .         .         .         .           g.85039
gatgagagctggggtcagaagagctgccaccaatgtaagccagaggtcagaagcccaggt  c.2282-181

.         .         .         .         .         .           g.85099
gagaagatgccctcccagtcccacacagggaccctggctcaggcagctgctggtccccgt  c.2282-121

.         .         .         .         .         .           g.85159
gagtgggcaactctgagtctcttgaatttagtcacagactctaggggaccaaaggacagt  c.2282-61

.         .         .         .         .         .           g.85219
gtggaaggtaggtccattctctccttcactaatcatctctttgcttttcctaccttcgag  c.2282-1


Powered by LOVD v.2.0 Build 28
©2004-2010 Leiden University Medical Center