von Willebrand factor (VWF) - 4073 nt intron 15 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.72874
gtgcgtgccctccctgcccgcagccctccgggccgccccccaaatccgtccacgtgtgct  c.1945+60

         .         .         .         .         .         .  g.72934
tttcgaagccctttctctgcgttgtttcctgtggaaagagggcgtagggcattgtgacaa  c.1945+120

         .         .         .         .         .         .  g.72994
acacgggtggggaggacggttcatttgcacccacttttcccttccacctcccagcaggac  c.1945+180

         .         .         .         .         .         .  g.73054
aggcggtggggaccggctgatgattcgggcctgttccaggaagacaggttggctcctcct  c.1945+240

         .         .         .         .         .         .  g.73114
acctggaggcctagaacgtgggggtccctgcaaagcttgggtttcccgtggccgctgcca  c.1945+300

         .         .         .         .         .         .  g.73174
cctagtgttcgttcagcacagaaggtcaggctgtggagcgaatgggtcccagatcccact  c.1945+360

         .         .         .         .         .         .  g.73234
gggtctccgcctcccttaagagtccgatgaaggcaagggaaattcacatacaaacccttt  c.1945+420

         .         .         .         .         .         .  g.73294
gcttgtaactccaggcaaaccaccgatggacaaaacctctggcgttgtataaagttacct  c.1945+480

         .         .         .         .         .         .  g.73354
aaaggtgaattacatcactgtccccagttggctttagattctcactctgcactgttggat  c.1945+540

         .         .         .         .         .         .  g.73414
tcctggcaccagaggtggtatctattgtgctcacttttttgtttttgttattgctctggg  c.1945+600

         .         .         .         .         .         .  g.73474
gacatttgctgcatgcccagtgtggtcgggcaacagtgatgatgtggaactccaaactta  c.1945+660

         .         .         .         .         .         .  g.73534
ctgttagagtcacagatggaaatggccgccctactagatacctatcctactaagtgaaag  c.1945+720

         .         .         .         .         .         .  g.73594
gatgagtagattcagggcagggaaaaccaaggaaggctttctggaggacgtgtacttggc  c.1945+780

         .         .         .         .         .         .  g.73654
tagggttttaaaaagctgctttcttggcagagaagacttgtttccaatggtagaatcata  c.1945+840

         .         .         .         .         .         .  g.73714
gtaggcatagaagtgacgagtatattctgttaagaataaggcatagtggatattctgttt  c.1945+900

         .         .         .         .         .         .  g.73774
tttagggtaaagtagatgtgtttagaaattaaaatgtaggtgtagtcccagctacttggg  c.1945+960

         .         .         .         .         .         .  g.73834
aggttgaggcaagaggattgcttgagtctaggaatttaaggctgcagtgagttatgatcg  c.1945+1020

         .         .         .         .         .         .  g.73894
caccactgcactctgacctggccaacagagaaagaccctgtgtgtgtgtgtgtgtgtgtg  c.1945+1080

         .         .         .         .         .         .  g.73954
tgtgtgtgtgtgtgtatacatatatatatatataaagtagatggtcctgttggaagagga  c.1945+1140

         .         .         .         .         .         .  g.74014
gttatgagaaacagtgaaaggaattagcatctatatttcaggagcagtgtaggcatgggg  c.1945+1200

         .         .         .         .         .         .  g.74074
accctagaagtgctactattttgggtccaatgagccaactcatgttttgagttgtagaaa  c.1945+1260

         .         .         .         .         .         .  g.74134
tgtcatatgaaagaggagcagagacaacagtaaggacgaaagggacgagcacataatgca  c.1945+1320

         .         .         .         .         .         .  g.74194
gccgttgtgccctccccattcctccagctctgggatgtcttggggagccacaggctaggg  c.1945+1380

         .         .         .         .         .         .  g.74254
gctgggacaactgggtctgggtccttactggcaactttcccgtgaggtaccagttatggg  c.1945+1440

         .         .         .         .         .         .  g.74314
accttgaacccttcacgtaacccctttgcacttcagtttcttccttagcatttgctattt  c.1945+1500

         .         .         .         .         .         .  g.74374
agaaattggggaaagtaatgaggagtgaatgagatgctgcttgtgaatattctttgcttg  c.1945+1560

         .         .         .         .         .         .  g.74434
tccaccagtgttagaaatgatgcattatcagtatgtggcagcatccgcaggatttcttaa  c.1945+1620

         .         .         .         .         .         .  g.74494
tttaggacattctcctggaatgctaagggcccactgaaatattctttaatctgtcatgaa  c.1945+1680

         .         .         .         .         .         .  g.74554
cagccattcttaacctccactgaacagaacaggggaaatgggctgatgcttcagtagtgg  c.1945+1740

         .         .         .         .         .         .  g.74614
ggataagattcagttaaagaatgtcttgactcctgaggcattacgatagggtagaaaggg  c.1945+1800

         .         .         .         .         .         .  g.74674
tggtaggaaggagctttccctggagactgttaaggacaagaggggtctgtctctgtgggt  c.1945+1860

         .         .         .         .         .         .  g.74734
ttatgtgacaagagactgggctgaccagatggccttgggctgtccctttgtacccaaggc  c.1945+1920

         .         .         .         .         .         .  g.74794
agttgggtaagtctcctgggttcttgccccaatcttttcttgacttggagaagagctcag  c.1945+1980

         .         .         .         .         .         g.74851
gctcagctgtcccctctacccacttccactttctcttccagagaaatgaacagagct  c.1945+2037

--------------------- middle of intron ---------------------
          .         .         .         .         .           g.74907
    ccctaaaccagtgaatctattcgtaagaagaggtcacatcaattggagacactcag  c.1946-1981

.         .         .         .         .         .           g.74967
ggagcacagacttaccatgtagctactttgtgggatggtgtgaggagattgatgagaagc  c.1946-1921

.         .         .         .         .         .           g.75027
acacacattttttttcctcttgcaaattggttgtgctccctttgggaagacaggaccaca  c.1946-1861

.         .         .         .         .         .           g.75087
ggctttctgaaggcaaggaccagggctggccatctctgcctccctgggcctagcatagcc  c.1946-1801

.         .         .         .         .         .           g.75147
cctggcatgcagtggatacacaagaagtgtctgctaaactgagatgtgcattgtttcttt  c.1946-1741

.         .         .         .         .         .           g.75207
ggggaagaaggctaaaggagaaatttaataaggctccaagccagccctagagatagccta  c.1946-1681

.         .         .         .         .         .           g.75267
tcagaacaaagaaagttctcaagtctagctgctttttaatgggtaaaatgtgcccttgtc  c.1946-1621

.         .         .         .         .         .           g.75327
attgtaggctcaggtggttgaaagacatctccatctttattgtctaacacatcctgtctt  c.1946-1561

.         .         .         .         .         .           g.75387
aacctacactccctcagtattcatccaataatccaacctttccattcttgcagagaaaaa  c.1946-1501

.         .         .         .         .         .           g.75447
tcaatgtctaataggattaaagaggccctcccttcccagctaccttcaaacaccaagttc  c.1946-1441

.         .         .         .         .         .           g.75507
agggtggttgtaggagcgggaggctgcagggtctctccagaggctccccactccattgtt  c.1946-1381

.         .         .         .         .         .           g.75567
caggctcacggccaaggcttacttttataacatctgtgaaatgccctgccagtaggtttc  c.1946-1321

.         .         .         .         .         .           g.75627
tgctggagcaatggatttgaacagagaggggaaggattgtgatggtctcagaagaagcat  c.1946-1261

.         .         .         .         .         .           g.75687
gcccagggtgaggttctcatttcttgggcagcagctggtctgcacagggaaggcattttg  c.1946-1201

.         .         .         .         .         .           g.75747
aaagggcagaatgctccccacaccttccctgtcctctaccctgcccataaggaattttgt  c.1946-1141

.         .         .         .         .         .           g.75807
caccagaatgccagagcttctgaggcctaggcctttctctggaacactccttccttcttg  c.1946-1081

.         .         .         .         .         .           g.75867
ggaccgctgagctggggctgtttccttagcaataagaataataattattatcagtgaaca  c.1946-1021

.         .         .         .         .         .           g.75927
ttattagcagtgaacattctccacatgccagacattcttctaaatgtgttagctcattca  c.1946-961

.         .         .         .         .         .           g.75987
accttcacaaagactgggtggatactgttattccatccagtgaggatactgcccaagatc  c.1946-901

.         .         .         .         .         .           g.76047
acacagccagctagtggtggacctgggcgtgaacccaggtatttgggatacagagcccgt  c.1946-841

.         .         .         .         .         .           g.76107
tcccttagctgcgttgccactttgctacacttccttctggcttgtgtctcttgcagtatt  c.1946-781

.         .         .         .         .         .           g.76167
tttctgtgggaggctagggagggtgagggctgtgggcagatgggtgcagcccatttcgct  c.1946-721

.         .         .         .         .         .           g.76227
gtggtaggcatgagtgtccctcctctttgggaccagcatgtcctcaaagggactgttttc  c.1946-661

.         .         .         .         .         .           g.76287
tttctagagagtaagggttatgagcatgagctttagggctgcagagagctgagttcaaat  c.1946-601

.         .         .         .         .         .           g.76347
ccttcctctgcttcttcctgtgaggtatacccctaacaagtcactcagcctaagtttctt  c.1946-541

.         .         .         .         .         .           g.76407
gaaagggggtgatgagagctaactcggcatgaggcatagagcccacgtaagagcaaggca  c.1946-481

.         .         .         .         .         .           g.76467
ttcagtaggtgctccataaatggtactcattgttgtcacggggtatgcccttgcccgtca  c.1946-421

.         .         .         .         .         .           g.76527
ttcccagtactttttaatattcacagcttcaaaacctgccaggatttctactacatccta  c.1946-361

.         .         .         .         .         .           g.76587
ggctttgagaattcagagatgactaatgcacattccctgtggttgaggaaaggagaaaat  c.1946-301

.         .         .         .         .         .           g.76647
gtgtgcccccataattataatacatatctgcatgctgaaaaatacacatttgctcatagt  c.1946-241

.         .         .         .         .         .           g.76707
gggaaaggaagttgatgaccatacagatataattgggggtcacttggggaaaactgggta  c.1946-181

.         .         .         .         .         .           g.76767
aagggtacatgggatctttctgcattacttcttgtaattgcaagcaagtctacaattatc  c.1946-121

.         .         .         .         .         .           g.76827
tcaataaaaattttaattaaataattgggggtcacagctacaaggggtggcaagtcctag  c.1946-61

.         .         .         .         .         .           g.76887
aaccacagtccttgctgtccaacattcccgctgaggccttacttctcctctctcttctag  c.1946-1


Powered by LOVD v.2.0 Build 28
©2004-2010 Leiden University Medical Center