von Willebrand factor (VWF) - 776 nt intron 14 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.71882
gtatgtgaacccgggggcaaggcagggacctcgcagaatctcgaggtctccacattagtg  c.1729+60

         .         .         .         .         .         .  g.71942
cagtgcgttccggaggcagtgctcccaccgcggagggcgggggcggggagcgaggaaagg  c.1729+120

         .         .         .         .         .         .  g.72002
ggtcgggctttgtttttaccgtcagcacttgatcatctgaactgggccatttgctcttca  c.1729+180

         .         .         .         .         .         .  g.72062
aagtccctttattgggcgcccgccacaggccaacccccgggaaagaaaaaaaaaaaaaaa  c.1729+240

         .         .         .         .         .         .  g.72122
gtctaccgaggcgggaggatcgcttgagggcaggagttcgagaccagtctgggcaacgta  c.1729+300

         .         .         .         .         .         .  g.72182
gggagcccccatttctattaaaataataataataataataataataataataataataat  c.1729+360

         .         .          g.72210
aataataaatttgccgggcgtggtgggg  c.1729+388

--------------------- middle of intron ---------------------
                    g.72211             .         .           g.72238
                    c.1730-388  cgcgcctgtaatcccaactacttgggag  c.1730-361

.         .         .         .         .         .           g.72298
ctacgtgggacggttgcatgaacccaggaaggcaaggccgcagtgagccaagatcgcatt  c.1730-301

.         .         .         .         .         .           g.72358
tctgcactccagcccgggcgacagagcaagaccgtgtctctccaaaaaaaaaaaaaaaaa  c.1730-241

.         .         .         .         .         .           g.72418
attccatagtccccgtccttcgaccttcccagtctactgcagcagcagcttacaaactca  c.1730-181

.         .         .         .         .         .           g.72478
gcgttagatgattgtaagataaatggacttgggggtgggggtggcatttgcagatttctc  c.1730-121

.         .         .         .         .         .           g.72538
tgcgtgaccttgcagccctctattagcagcactgggctatttccaggggagtgttgaccg  c.1730-61

.         .         .         .         .         .           g.72598
ggagggcgtggcccccactcctccccaccacatcccaggctcgctcctctcgccccacag  c.1730-1


Powered by LOVD v.2.0 Build 28
©2004-2010 Leiden University Medical Center