von Willebrand factor (VWF) - 4909 nt intron 13 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.66777
gtaggtgccctcacggggtactggctccctgcggcccgacccttacaaagtaccccttgt  c.1533+60

         .         .         .         .         .         .  g.66837
gctctgggtagaatggctttgtgtggtgggagaagaattcctttctcctcatggcctaca  c.1533+120

         .         .         .         .         .         .  g.66897
cccccagagcgagaaacaggcctctcttgtttatgaggctggtgtttgttttctggatgc  c.1533+180

         .         .         .         .         .         .  g.66957
cccttcttggccctggggattcttcctgctgggctctgctatcccaagggcctctagact  c.1533+240

         .         .         .         .         .         .  g.67017
ggggtgggctcttgtggggctggggaaggagcaggtttgctgtccaatctcccggctgaa  c.1533+300

         .         .         .         .         .         .  g.67077
acaaggcccgggagcaggggtgtctccctgggtgcccactgtgggcagtaagggaagagc  c.1533+360

         .         .         .         .         .         .  g.67137
cagattggcactctcagctaagagaaagcctgcccgggaaaggttgctcaggaaaccacc  c.1533+420

         .         .         .         .         .         .  g.67197
agattcttcccctggacactgggactctgcatgtgtgggccacttcctcttgttcttggt  c.1533+480

         .         .         .         .         .         .  g.67257
ggtcctggaatcacactggatagcaatccatacttttcactgtttctctggaaatgaccc  c.1533+540

         .         .         .         .         .         .  g.67317
tggcaggtggacagtgcaaatattactgccattttataaatgaggcaaccagggcacagg  c.1533+600

         .         .         .         .         .         .  g.67377
aagtggagggatggtgcagcactccagaacttccagggctaggatagactcctctgatca  c.1533+660

         .         .         .         .         .         .  g.67437
gaggactgatcccactctgacccccaccaaccgtgtcatggcagagcgaggattagttct  c.1533+720

         .         .         .         .         .         .  g.67497
ctgcctcatgcctttcccatcagaacaaaaagtggttctcgctttttggtcttgaatgcc  c.1533+780

         .         .         .         .         .         .  g.67557
tttacactcttaaaaattattgaggacctcaagatcttgtaggaggattatatttattgg  c.1533+840

         .         .         .         .         .         .  g.67617
tatttatcagattgaaaattaaattagagacatttaaaatatgtatttattaactcattc  c.1533+900

         .         .         .         .         .         .  g.67677
aaaaattataataataaacccactacacattaatataaacatcactgttttggggaaaag  c.1533+960

         .         .         .         .         .         .  g.67737
taactgtttgccagaacaaaaataagcaacaagaataataccactgctgcacatttctgc  c.1533+1020

         .         .         .         .         .         .  g.67797
aaatttctttaatggctggcttaataggagacagctgggttctcatatctactgctgcat  c.1533+1080

         .         .         .         .         .         .  g.67857
tcaatcttttgcaatattgcatgtcatgtggcctctggaaaattccactctatacttgta  c.1533+1140

         .         .         .         .         .         .  g.67917
agagaatgaggagggaaaaggcaaatagcgtcttcatagtattatgaaagtagttttggt  c.1533+1200

         .         .         .         .         .         .  g.67977
ctcgcagaccccttgaaagtctcagggacccctatgggtctcaagaccacactttgagaa  c.1533+1260

         .         .         .         .         .         .  g.68037
ccactgcgctagattatgcctgggatccctggagagcctcctcctgcctcctggggtcct  c.1533+1320

         .         .         .         .         .         .  g.68097
gtattccacagggtccttgctataatcctgggtggcaggggcagggtggcaggtttcacc  c.1533+1380

         .         .         .         .         .         .  g.68157
caggagatcctggcgtcctccatcctcgtgtggctatgttctttctcctgtcttagagct  c.1533+1440

         .         .         .         .         .         .  g.68217
cctgagggaatttcaaactaactcctttttttttttttttttccttttatgaaaataaac  c.1533+1500

         .         .         .         .         .         .  g.68277
ctgcaaccacagaccataaagcaggaaggtctgggagatcctcttgtcaacctccctttt  c.1533+1560

         .         .         .         .         .         .  g.68337
ccagtaggaaataaagagccattatttctggagcaggagtaacttgccctaggcctcatg  c.1533+1620

         .         .         .         .         .         .  g.68397
gtcgtttagttaccgggcaaggaccagaactcgggtctcctggttcctgaccagtcttgc  c.1533+1680

         .         .         .         .         .         .  g.68457
ctcctgcaccccggtcttcaagggggtgcttcacgttagccagttcactttctttttgtt  c.1533+1740

         .         .         .         .         .         .  g.68517
tgttttgttttttgagagagggtctcactctgttgcccaggctggagggcagtggcacga  c.1533+1800

         .         .         .         .         .         .  g.68577
tcttggctcaccacaacctccgccttccaggctgaagcgattctcctgcctcaacctccc  c.1533+1860

         .         .         .         .         .         .  g.68637
gagtagctgagattacaggtgcccaccatcatgcccagctaatttttgtatttttaatag  c.1533+1920

         .         .         .         .         .         .  g.68697
agatggggtttcaccatgttggccaggctggtcttgaactcctgacctcaaatgatccac  c.1533+1980

         .         .         .         .         .         .  g.68757
cctcctcagcctcccaaagtgctgggattacgggcatgagccaccacgcccggccagcca  c.1533+2040

         .         .         .         .         .         .  g.68817
gtccactttctcagcatcttcccacctcacagagagggtgctctccacccatgcactttc  c.1533+2100

         .         .         .         .         .         .  g.68877
tccccttgatcagcagggccgtaacttctcatcctgggcagctgcccttcctcccctcag  c.1533+2160

         .         .         .         .         .         .  g.68937
gtttctttggtctttgtctctcccctgaggagaagagaagccaacttctttctgtgggag  c.1533+2220

         .         .         .         .         .         .  g.68997
gggatgtagggttatctttggggtgggtttgtgtcagtttagctaacaagaagacgtttc  c.1533+2280

         .         .         .         .         .         .  g.69057
cttggccaaggttcaggacagggtcagatgaccccatggcctatagaactgtctttttat  c.1533+2340

         .         .         .         .         .         .  g.69117
atatatttttcttttttctttttctttacacagattcctggggctcatggaaagggacta  c.1533+2400

         .         .         .         .         .       g.69172
tcttgtgggttttattatgaagcaggaaagggggtgtttgagttggggcaggagg  c.1533+2455

--------------------- middle of intron ---------------------
          .         .         .         .         .           g.69226
      tggggagcctcagaatactgacaccagggcttttggggatggaagtgtggaggc  c.1534-2401

.         .         .         .         .         .           g.69286
gagagctggagggaggccagctggggcagaggcggtgcaagaggaggtgcagctaggggc  c.1534-2341

.         .         .         .         .         .           g.69346
cccccggtctccttcccctgggtgtgttatgtacgctttgtccccgtggggctggcggtc  c.1534-2281

.         .         .         .         .         .           g.69406
caggcagcaaggctccagccagcagaaatcacatcctctgtgtgctgcttccctgccctg  c.1534-2221

.         .         .         .         .         .           g.69466
ctggctgccctgcagggcccagctctgccttaggcatagcagtgtggaaaagatccttgc  c.1534-2161

.         .         .         .         .         .           g.69526
acaggcttcatttagtcagaactgtcactgaccagaggtttatttcaaatagtgagtgtc  c.1534-2101

.         .         .         .         .         .           g.69586
gctaagtgacactaagagagtctctaagtgtcgcccccactctcctaaccctggccgagc  c.1534-2041

.         .         .         .         .         .           g.69646
tgacctccgagacaagccaaggggatgggagaagacctggttttagagtgggacatggga  c.1534-1981

.         .         .         .         .         .           g.69706
gtgatggctggcttggtgggggtgaatgaaaacgcctttggggagcatcaaactctgaga  c.1534-1921

.         .         .         .         .         .           g.69766
aaggagagagaaaagatgctgagaggcgggaagggagtggaggtgcaccaccagttatgc  c.1534-1861

.         .         .         .         .         .           g.69826
cgccttgcccagggtgccctgactgcgggcattgcattccagcacatcaggaggagaacc  c.1534-1801

.         .         .         .         .         .           g.69886
tagtcattcacttacttattcattcatttgttcaacgattcattcattcaacaaacactt  c.1534-1741

.         .         .         .         .         .           g.69946
actgagtgtctgctggcactgctgtggactgaatgtctgtgtcctccccaaatttatatg  c.1534-1681

.         .         .         .         .         .           g.70006
ttgaaatcctaacccccaaggtgatggtgttacgaggtggggcctttgggagatgatgaa  c.1534-1621

.         .         .         .         .         .           g.70066
gaatgagatttgtgcccttttaaaagacctcagagagcttgctagccccttccaccatgt  c.1534-1561

.         .         .         .         .         .           g.70126
gaggacacagctagaaggcaccatctatgaaccggaaagcagggtcctcaccagacacca  c.1534-1501

.         .         .         .         .         .           g.70186
aatctgctgatgccttcatcttggacttcccagattccagaactgtgggcaatcaatatc  c.1534-1441

.         .         .         .         .         .           g.70246
agttgtctataagccacgcagtctgtggtattttgttatagcagcctggaagggctaaga  c.1534-1381

.         .         .         .         .         .           g.70306
caggcaccattctggatgctgagattacagcagtgagacaaaacagacaaaaatccttgc  c.1534-1321

.         .         .         .         .         .           g.70366
ctcatttagcttaagttctaatggagagagacagacaataaacaaagcaaacaagtaaat  c.1534-1261

.         .         .         .         .         .           g.70426
tatattatagatcggaaagtgatagatcctgggggaaataaagcagagaaaggggcagga  c.1534-1201

.         .         .         .         .         .           g.70486
tgtgccaggattggggggatttaaattttaaataaggaggtgggagaaggcctaatgtga  c.1534-1141

.         .         .         .         .         .           g.70546
caacatttggtatttgtcaagcaaacaaggaaacattactctgtcccctttcttaacagt  c.1534-1081

.         .         .         .         .         .           g.70606
gtttacttgggttcgatttctatgggcctgggaccttctactggattgttaaccctgcat  c.1534-1021

.         .         .         .         .         .           g.70666
tttgttaggttggagctggaagctgaaaaggggctctaagagctgaccctagcccctgag  c.1534-961

.         .         .         .         .         .           g.70726
ggattcagaacgcagggaggtcatcccaccttggtaatgacatgcggagagggagtcagg  c.1534-901

.         .         .         .         .         .           g.70786
actcctgggtcccagcccccgctccaccttcaaatcggggtcctctccgtagaaaccagc  c.1534-841

.         .         .         .         .         .           g.70846
agatgcccccagctgtgtgggggaagggcgggctccactctgctggttgttcccgaatgt  c.1534-781

.         .         .         .         .         .           g.70906
gcactttgggctcagaactttgttcagttctgagaatggacagtaaaccacatgctcatg  c.1534-721

.         .         .         .         .         .           g.70966
gcctggagtttgaactgtgccgctgctttgctgctgtcaccctggcaggctgcctcagag  c.1534-661

.         .         .         .         .         .           g.71026
cctctgcagactcctactcctatccatcatcaccctcagagtcttctgtggctcgtggcc  c.1534-601

.         .         .         .         .         .           g.71086
ctttctcttcagtgatgcccagggcctgagtggcaggcagcaggttgtggggaggtgttt  c.1534-541

.         .         .         .         .         .           g.71146
cttgtcattaaccgtgagctcccggagggcttggaccacacctggcagcctgctgggccc  c.1534-481

.         .         .         .         .         .           g.71206
acaccgagtgaccaacgcgaagtctttctatatagaggggccttgagtttgcacgtaact  c.1534-421

.         .         .         .         .         .           g.71266
ctgggtgggggggtcaggcccactggtgtggatggcacagagggcagagtgcttcgggct  c.1534-361

.         .         .         .         .         .           g.71326
gggctcaacctgcctactcaccctagctccgccactacctccctgaccttaggcaagtca  c.1534-301

.         .         .         .         .         .           g.71386
ctttgcctctttgggcctcccttctccatccttagatgatctgataatttctaaaatctc  c.1534-241

.         .         .         .         .         .           g.71446
ttgtggcagtacagggctctgatgatttgggaacagggatggagctggtaaatttacact  c.1534-181

.         .         .         .         .         .           g.71506
gcagttcactttcccccgcccccccttttgcagcctagggcttagctgccttttattaca  c.1534-121

.         .         .         .         .         .           g.71566
ttcatatttatgtttcacccggggaacttttttttttttattaaaaccatctcattagct  c.1534-61

.         .         .         .         .         .           g.71626
aaacaactatgccgctgctttcgcggcagcggctccagagtggcctggtctctcctgcag  c.1534-1


Powered by LOVD v.2.0 Build 28
©2004-2010 Leiden University Medical Center