von Willebrand factor (VWF) - 1191 nt intron 12 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.65485
gtatgcttcgtcctgctccatcaggcctggggctggcacagcccatcccttagcaccctc  c.1432+60

         .         .         .         .         .         .  g.65545
cttctcaaccctggccactgtccttaaggacctgcatgcctcttccatgggaatgtgatg  c.1432+120

         .         .         .         .         .         .  g.65605
gagagttatttttggagggcagggtggggtgcttggcatgcatccctccaagaaaggaag  c.1432+180

         .         .         .         .         .         .  g.65665
gcttcctggaggaggaagactagagaaggaagcctatagatgaagaggttgctctagacc  c.1432+240

         .         .         .         .         .         .  g.65725
tgggacagagtgtagatgggaaaagggaaccgagaggatttttatttggcttgaaccaaa  c.1432+300

         .         .         .         .         .         .  g.65785
ggggcgagttgagtcttgggcaggtggttctggtttgctctggggtgggacaggggcaga  c.1432+360

         .         .         .         .         .         .  g.65845
ggctgatgctgagagatcgggggtggctggtgatgtcacaccagaggatgccacttgggg  c.1432+420

         .         .         .         .         .         .  g.65905
cgaggccaggtgaccctctggcctgtctagaggtagcaaaaaacctacctgtccagtatc  c.1432+480

         .         .         .         .         .         .  g.65965
ttcacctgggttgcactgtgccggtcaaagcaaacctgcttttgcatggtaaagctccca  c.1432+540

         .         .         .         .         .        g.66021
aacttcacactcaaagtggctctcagactcttccttcttctccacaactgctggcc  c.1432+596

--------------------- middle of intron ---------------------
          .         .         .         .         .           g.66076
     actttgtcgcccattatcctagcattgcacacagcggatgaacttgggctagtgg  c.1433-541

.         .         .         .         .         .           g.66136
gtacccagcacgtccatgggtgttatgctgtgtgtctccttataagatatgtttgttccc  c.1433-481

.         .         .         .         .         .           g.66196
ccagggcaaggggtgtgctcctatctgtcgccaccttcccacagaagcaacaattgctgt  c.1433-421

.         .         .         .         .         .           g.66256
attcagtgtcgtacacagcatcgctcagacatgaggtggtgtgcagtggcagagtgtccc  c.1433-361

.         .         .         .         .         .           g.66316
aggcacattcagatgtcgtggtgtcaatgctaaagagatccccctctgctccagggcacc  c.1433-301

.         .         .         .         .         .           g.66376
tgcctacagcccaggatgcaggagcctctgcctccctcctgtggcagtagggggaatggc  c.1433-241

.         .         .         .         .         .           g.66436
aggtcatagcggggggtgcagaggcttcttcctgggggaccctatttgcgctctgtccac  c.1433-181

.         .         .         .         .         .           g.66496
cttgatcacccttcctcctgacacccccttaaacctcatggccaccccatctgcccctaa  c.1433-121

.         .         .         .         .         .           g.66556
gtcattgctcttcagtgctaccatccttttgagacaccccatttcctcccaaatacatct  c.1433-61

.         .         .         .         .         .           g.66616
gcctgccaccaccctgtcctctccccacctctgcctgagtcctgtcctgctgggttccag  c.1433-1


Powered by LOVD v.2.0 Build 28
©2004-2010 Leiden University Medical Center