von Willebrand factor (VWF) - 752 nt intron 11 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.64594
gtgagctttgccagcccggctgctggtcgggtggtagcccaaggtgctgcatagctgcta  c.1293+60

         .         .         .         .         .         .  g.64654
ggctgaatgggcagtccctggaaggcgtggggcattgctttctgtgcatgagggaggtct  c.1293+120

         .         .         .         .         .         .  g.64714
cttccagacttcagttagctcctcattcatccagaaacccagcccatcccctctctccct  c.1293+180

         .         .         .         .         .         .  g.64774
agatgctggcggaaggcatcctgccctgacaataatgcctcctcagggctggctcagctc  c.1293+240

         .         .         .         .         .         .  g.64834
cccacccagtggacgcatcctgcttgggtctagcctgttgcccccataactaaccctctg  c.1293+300

         .         .         .         .         .         .  g.64894
atgtttggagctggggatggctggggtgggggcaaagagggctggtcttctcttctgaac  c.1293+360

         .        g.64910
tctgtggtacatgtgt  c.1293+376

--------------------- middle of intron ---------------------
                                g.64911           .           g.64926
                                c.1294-376  ggcttcctttctgtag  c.1294-361

.         .         .         .         .         .           g.64986
ggatggaagcaaagatgaggacgaagagaatgcacagggctttccttgaggatcaaagtc  c.1294-301

.         .         .         .         .         .           g.65046
tttgattctctttggaacagtaggtccaaggaacacgatgaagcagaggcccatggttct  c.1294-241

.         .         .         .         .         .           g.65106
ttataagagactgggccaggctgggagaaggcgtgtgcaaggatgcacttagcaagcctt  c.1294-181

.         .         .         .         .         .           g.65166
cttgctgcacaactctagggggccccattcacatggagtattctgggagaatggagttgt  c.1294-121

.         .         .         .         .         .           g.65226
aggttatgagaaggccagaggctctcgggttgaggcctttctctgattaagagggtcctg  c.1294-61

.         .         .         .         .         .           g.65286
ggctggggagctggataggcagggggtgcagcaaagtcaccctgtgttccctcttggcag  c.1294-1


Powered by LOVD v.2.0 Build 28
©2004-2010 Leiden University Medical Center