von Willebrand factor (VWF) - 987 nt intron 09 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.57400
gtaatgggggctgcgcagcgtgctctgggagacctgcctgggggactggggagggaagct  c.1109+60

         .         .         .         .         .         .  g.57460
gggtcagcaggggtggtggcaggtggaaaagaacctggaccgtgccaagaaagaagagac  c.1109+120

         .         .         .         .         .         .  g.57520
tgagttggaggctactggtgggggctagggacaggtgtggcaggcaatgatggggagcaa  c.1109+180

         .         .         .         .         .         .  g.57580
agagtatattacagataaataagccttgaagatggggaggtcaggaagggcaggatcctt  c.1109+240

         .         .         .         .         .         .  g.57640
cacgtgcagacatcatctctagctgtccctccaaactatgctttcataaatgatcctttc  c.1109+300

         .         .         .         .         .         .  g.57700
cccctggaggagggctgtatcactaagcagtacgtaggtccttctctccttgaaatctct  c.1109+360

         .         .         .         .         .         .  g.57760
catctgctaggtggtaggaagttgcagtggccagtggaaactcacaccagtctgccctcc  c.1109+420

         .         .         .         .         .         .  g.57820
cttggtccctgcagtaggccaggcccagcctggcttctgtcatctcaagaagcacccctg  c.1109+480

         .      g.57834
gatgtcacctctgg  c.1109+494

--------------------- middle of intron ---------------------
                                   g.57835        .           g.57847
                                   c.1110-493  ctggctttgccag  c.1110-481

.         .         .         .         .         .           g.57907
tctcctgcacagcagggacaactcgtttggtccccaggcctcctccctttgctatcttag  c.1110-421

.         .         .         .         .         .           g.57967
cagccttctgtgtgcactgagcccccaggttctcagtcggccaccgcccaccacacttct  c.1110-361

.         .         .         .         .         .           g.58027
gggctgggagctacccatttccatatcgctctcttgctctctgccactcactgtgtgtgg  c.1110-301

.         .         .         .         .         .           g.58087
ggtaggaatttgacttcttggtatctgagtagattttcagggggatcaggtagttttttt  c.1110-241

.         .         .         .         .         .           g.58147
ttctttcttctttttctctgttggggtttcttcccctgggtaatatctctaagattcctt  c.1110-181

.         .         .         .         .         .           g.58207
tgtggccaaagctctgtcctgtacaattttaaccctatgaagattctgctagcaccagct  c.1110-121

.         .         .         .         .         .           g.58267
cttttcttttcccacatcccttcgtttggggactgtgataactaccatgagctctaaatc  c.1110-61

.         .         .         .         .         .           g.58327
catttgcatacccttgtgtttgcagaaccaccaatgacctgtgctttttccctccaacag  c.1110-1


Powered by LOVD v.2.0 Build 28
©2004-2010 Leiden University Medical Center