von Willebrand factor (VWF) - 1176 nt intron 08 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.56112
gtaatgaacttcccactttatttacagatcagagaccttgccagcacccttggctttggg  c.997+60

         .         .         .         .         .         .  g.56172
aagtgagatgaaggccacttgtgtttgctccccgttgctgaaatcagaagccttttatta  c.997+120

         .         .         .         .         .         .  g.56232
agtttttaaatgtctttgtccagcgtgatcaggattgagctggtctttatttttaatgta  c.997+180

         .         .         .         .         .         .  g.56292
cgttgtcctgttgtactgtatccatgaacgcacttgtgttgagggaaattggagggtggc  c.997+240

         .         .         .         .         .         .  g.56352
ctgggccccaacagtaactttgtttggggaactcgtggcccatctgagctgagctgtttt  c.997+300

         .         .         .         .         .         .  g.56412
ctcaattaggtgtgtcagggaaccgatctgggaaaaagatctcctgggtttgtcatgtga  c.997+360

         .         .         .         .         .         .  g.56472
gctcagctgaaaaagggctctgcactagaaagtcttttcaggggaggcttggtgggcttt  c.997+420

         .         .         .         .         .         .  g.56532
ggggaaaacccctgtttaattactgagagcaaggctgggtgcggtggctcatgcctgtaa  c.997+480

         .         .         .         .         .         .  g.56592
tcccagcacttttggaagccgagatgggcggatcacttgagttcaggagtttgagaccag  c.997+540

         .         .         .         .          g.56640
cctggccaacctggtgaaatcccgtctccactaaaaatacaaaaatta  c.997+588

--------------------- middle of intron ---------------------
 g.56641            .         .         .         .           g.56688
 c.998-588  gctgggggtggtggtgcacacctataatcccagctacttgggaaactg  c.998-541

.         .         .         .         .         .           g.56748
aggcaggagaatcacttgaacccaggcggcggaagttgcagtgaaccgagatcgcaccac  c.998-481

.         .         .         .         .         .           g.56808
tgcactccatcctgggtgacagaacgagactcggtctcaaaaaaaaaaaaaagttattga  c.998-421

.         .         .         .         .         .           g.56868
gagtgagtcctgtgtgtttcaactcatgacttctctactggaagaacttgaacaaaactc  c.998-361

.         .         .         .         .         .           g.56928
ttgactcccttcatctgtggaatggtaatgagtagtcttctccctctcacgttgcattaa  c.998-301

.         .         .         .         .         .           g.56988
tgtgtaagggaagcagcacacacattcttgagcttcctggaagaagccctaagcccagac  c.998-241

.         .         .         .         .         .           g.57048
ttgtgcctcccctactggatgacctggaacaaaattcttttgctcatgtcttcatctgta  c.998-181

.         .         .         .         .         .           g.57108
gtaatggagatgaggaatttcccttccttatattgcattatgtgaaagataaacaccaca  c.998-121

.         .         .         .         .         .           g.57168
gaacaagttctttgagcttcctggaagaaacccaaccattgtccctggggattctatagt  c.998-61

.         .         .         .         .         .           g.57228
tgtgggatgagtgacgcaatgacaatgttgaggcctttgtcttgatgcccttgaccccag  c.998-1


Powered by LOVD v.2.0 Build 28
©2004-2010 Leiden University Medical Center