von Willebrand factor (VWF) - 1593 nt intron 07 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.54396
gtaagtcggccccctgccccgtcctgccctgccggggatgaacggtctgtcctgggtggt  c.874+60

         .         .         .         .         .         .  g.54456
gtcccttagggtgcttcggggctgtgtcacgtatgtgcggctttaccacacccagccagc  c.874+120

         .         .         .         .         .         .  g.54516
cagtgactacaaagccacgtgtcccggacccatttcctgaatggctcctgccctctgtca  c.874+180

         .         .         .         .         .         .  g.54576
aacgggcttcccaaagccccgtgtcctgcccctgcctccgtcccgcccccacgcctcccc  c.874+240

         .         .         .         .         .         .  g.54636
tggcgccccctgacttccctcaggaaatccgacccctgcactcacacagtgttctctgct  c.874+300

         .         .         .         .         .         .  g.54696
tcccaccaagatcttggcagttgcggttttggtttttgtcttcaccgcctgcccgcccga  c.874+360

         .         .         .         .         .         .  g.54756
attgatgaggagcaggacgctgacctggctgtccgtgtgtggtgatctttgagagagcag  c.874+420

         .         .         .         .         .         .  g.54816
aaagcattcattaagttcttctcttttattaaatctctctcctccaggctaatgaccgct  c.874+480

         .         .         .         .         .         .  g.54876
atccctcctgccttactcgtgctgtgtgtttcatcttccagtctcaatgggtgcctagtt  c.874+540

         .         .         .         .         .         .  g.54936
atggtcactgtccccaaattatcaggattaagtggggacttctgaggtcaccttgcaaga  c.874+600

         .         .         .         .         .         .  g.54996
agtctcctctttccccagcccttccagtgattaaaagccatgcagacggataagcagtct  c.874+660

         .         .         .         .         .         .  g.55056
gtgatggttccacagatgagctgagccggccacatctttacactgcacacgtgtgtctca  c.874+720

         .         .         .         .         .         .  g.55116
gtgtgtggcaaatagctgctgaattcaaactttctgcctgtggtgggggtgtgaggaagg  c.874+780

         .         g.55133
aggatgctagcagctgg  c.874+797

--------------------- middle of intron ---------------------
                                 g.55134          .           g.55149
                                 c.875-796  tttcttctctgtaaag  c.875-781

.         .         .         .         .         .           g.55209
ccgagtggctgtttttttttttttttttttttttaggtctgtgaatgtagggtaggggag  c.875-721

.         .         .         .         .         .           g.55269
ataacctgatgtatcttggagaagggttaaggggcaatagtttggtgtcagaaagcccag  c.875-661

.         .         .         .         .         .           g.55329
aaaagagtgcttatgtgtttcggtctttcagtcagcctgaatgtcgctcagctacagggt  c.875-601

.         .         .         .         .         .           g.55389
agagagaggaaggaggagagcctgtccttgcagtgaggagctggttccattgggaagaac  c.875-541

.         .         .         .         .         .           g.55449
agagagtgcttaggtgatatctgtgaaggcagccttgtggcagagtggaaataaatatgg  c.875-481

.         .         .         .         .         .           g.55509
aatgagtgtcaccatgcaggcaaatgtgccctgtgctgggtggggcatttgattggggcc  c.875-421

.         .         .         .         .         .           g.55569
aatttcatggggaaaaggaggagggatgggatggagggcaccatggctccttgctttgtc  c.875-361

.         .         .         .         .         .           g.55629
gtaggactccacttgttttgagcctagaggagtttggtgtcactctgaaagggttttagg  c.875-301

.         .         .         .         .         .           g.55689
tgaaggggaggaaagaatgccaagttatacatggagagcaggcgaccaaggggaagggtg  c.875-241

.         .         .         .         .         .           g.55749
ggggtcctgggtgcccccgatgggtcttggtaagggcctcacaagatggaagatgttcat  c.875-181

.         .         .         .         .         .           g.55809
ctaagggaggggtggcctcaggggggcacgtggctcactgggggtgagaaggacctggaa  c.875-121

.         .         .         .         .         .           g.55869
gcctgaagacagaggggagcagtcagagtgggcacgagaggctcaggctgtggcatggct  c.875-61

.         .         .         .         .         .           g.55929
ggtgagatgatgcaccggtgggacctgccctgggtagacccctttgatgttccttttcag  c.875-1


Powered by LOVD v.2.0 Build 28
©2004-2010 Leiden University Medical Center