von Willebrand factor (VWF) - 283 nt intron 04 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.18865
gtaagccaacaatgtctgagttagaaaggaccctagggatcccctgacacaaccccctca  c.323+60

         .         .         .         .         .         .  g.18925
tttttagatgaggaagctggggcccagagaatggaagcaaatgttccaaggaagtgagta  c.323+120

         .         .    g.18947
gcagggctgggtgagagccagc  c.323+142

--------------------- middle of intron ---------------------
                            g.18948     .         .           g.18968
                            c.324-141  tctcccgattgctgatctagg  c.324-121

.         .         .         .         .         .           g.19028
tcctcagccactttgcaccatgttctgaaccctacaacatggggttggggttagaaggtg  c.324-61

.         .         .         .         .         .           g.19088
ggagagacatccagaaaatgcacaagaagcccacttctgaacttagcctttgccctccag  c.324-1


Powered by LOVD v.2.0 Build 28
©2004-2010 Leiden University Medical Center