von Willebrand factor (VWF) - 1803 nt intron 02 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.6589
gtaggtacaaaagggcctccatttctcattcctgccccagggccatctggagtgacacct  c.55+60

         .         .         .         .         .         .  g.6649
ttccgggaatcagcaggtgtgtctggagctcacctgtgtgcccagccctaacttaggctg  c.55+120

         .         .         .         .         .         .  g.6709
ttggttgcctcctgtgaaggttctgcggagttcccacccttgacttgtattccagagacc  c.55+180

         .         .         .         .         .         .  g.6769
aggtgcctgcaaatgccatctcctgttggggaattaagaagcataaaggtggcacagaac  c.55+240

         .         .         .         .         .         .  g.6829
tgtcctatattatgggggcacaggatgaggaggaaggaatccaagacttggatggattat  c.55+300

         .         .         .         .         .         .  g.6889
tagttttcgataagattgtggaggtcaccttgttgaacctcccatggtacaatgaagaga  c.55+360

         .         .         .         .         .         .  g.6949
ctgagggtcagagaggagaaatgactgctccaaagtctcctagagccaaaatcagaggtc  c.55+420

         .         .         .         .         .         .  g.7009
agtcttcctgggttccaggccaacaccctttccactgcactgcatcatactgctgccctt  c.55+480

         .         .         .         .         .         .  g.7069
cccttgctaagattctgggtctgcaaatggcgggaggggacttttgaccttgggcgcttt  c.55+540

         .         .         .         .         .         .  g.7129
ccacttagatctctcaggtcagcagcatccagctactgcccacaggtgagtctgggaaaa  c.55+600

         .         .         .         .         .         .  g.7189
aaaatacacatttgtcacactctctgcatcttcctactaggtgggtcttttgccggggaa  c.55+660

         .         .         .         .         .         .  g.7249
cccagaacacttagagatttactgctgtatttccccacctgccgacacacacacacccat  c.55+720

         .         .         .         .         .         .  g.7309
agtcagtgaaggagttagcctgtgacgccggaggagttcacacttcagagagtctatgtg  c.55+780

         .         .         .         .         .         .  g.7369
tcaggcacacagtctgatctgtttaaaatttaacatgcccaagacatgctagtagattta  c.55+840

         .         .         .         .         .         .  g.7429
tgtacaaagatgctcactgcaatctatctataatattaaaacatggaaaaatgctagaaa  c.55+900

    g.7431
cc  c.55+902

--------------------- middle of intron ---------------------
                                                 g.7432       g.7432
                                                 c.56-901  t  c.56-901

.         .         .         .         .         .           g.7492
aacaatagagggctatactatagacattcagatgcaaaatataatgcagccactaaaaac  c.56-841

.         .         .         .         .         .           g.7552
cgcatattggaagtatatacactagcacgacaaattgtttacaatctattgagaaataaa  c.56-781

.         .         .         .         .         .           g.7612
cagaggttataggtagtttgcacaagttggtcaccaatttataaaaaacccacagctgta  c.56-721

.         .         .         .         .         .           g.7672
tatatgctatacaacaaaatggaaagatgaacattgaaatgttaactctaatcatcgctg  c.56-661

.         .         .         .         .         .           g.7732
aatgttgggttacagatggttttaacttctttgtcttttcttttctttttctttttcttt  c.56-601

.         .         .         .         .         .           g.7792
tttttttcgagacagagtctcactctgtcgcccagtctagagtgcagtggtatgatgttg  c.56-541

.         .         .         .         .         .           g.7852
gctccctgcaacctctgcctcctgggctcaagtgattctcctgcctcagcctcaccagta  c.56-481

.         .         .         .         .         .           g.7912
gctgggattacaggcgcccaccactacacccggctagtttttgtatttttagtagagaca  c.56-421

.         .         .         .         .         .           g.7972
gggtttcgccatgttgggcaggctggtcttgaattcctgacctcaggtgatctgcccacc  c.56-361

.         .         .         .         .         .           g.8032
tcggcctcccaaagtgctgggattataggcgtgagccactgtgcccggccagcttctttg  c.56-301

.         .         .         .         .         .           g.8092
ttttcttctgtatgccccaaatttttaataatggacatgatgacattttaaatcagtaag  c.56-241

.         .         .         .         .         .           g.8152
taaatgtcattgaaactaatggatttcctgaaaaactgttccttagttattgctgtgagt  c.56-181

.         .         .         .         .         .           g.8212
ctggggtcatatctgggagctgaaagcaacagctttagtctcatttaggatggaaaatac  c.56-121

.         .         .         .         .         .           g.8272
ctccccacagcccagtttctatcagaggcagtctaatttctacgaggccagagaggtttg  c.56-61

.         .         .         .         .         .           g.8332
agctgatggtcccagttgtgccctgagatcaccagcccaacctgtggcctctccctccag  c.56-1


Powered by LOVD v.2.0 Build 28
©2004-2010 Leiden University Medical Center