von Willebrand factor (VWF) - 1224 nt intron 01 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.5310
gtatggcctttggaaggagagctggctcagttgtgggaggaagatgcaggactgactgat  c.-1+60

         .         .         .         .         .         .  g.5370
ccctgctcctggggagctggagttctctgtcgctggactagaagggctttgtttggaggg  c.-1+120

         .         .         .         .         .         .  g.5430
gcaattcaattcagccagggatgatcctaatactccctcctccacttgcctctgagggtc  c.-1+180

         .         .         .         .         .         .  g.5490
ctggggctgcttttcttcatgcagtgggttttactgtttgatagtacttcactcaaatga  c.-1+240

         .         .         .         .         .         .  g.5550
gttggaatgaagtttgccctcacctctgagaacctgggagcagctgaatgtacctgcgtg  c.-1+300

         .         .         .         .         .         .  g.5610
ttaggactgggaggggacacctgcttggagaccgagacctggcagtatctgacatctcag  c.-1+360

         .         .         .         .         .         .  g.5670
tgttccttccacagatgtatcacagattggcttgatttcacctttggctggatgggacct  c.-1+420

         .         .         .         .         .         .  g.5730
taggtaggaagggagtcacccccagtgaatctcaggcagcagattctgcacttcatttaa  c.-1+480

         .         .         .         .         .         .  g.5790
caacttttcccgaggagaggggctacagcaggggctctaagtgacttggggtacgctctg  c.-1+540

         .         .         .         .         .         .  g.5850
ccagccaggatgaattgtccctctcttgggggtcacacagtggggaagtctgcctgcatc  c.-1+600

         .    g.5862
cagggccgctgg  c.-1+612

--------------------- middle of intron ---------------------
                                       g.5863     .           g.5874
                                       c.1-612  actcctgtccat  c.1-601

.         .         .         .         .         .           g.5934
tttttcagatgaactcagcaaacatttgctgggcatctcctgggtgctaagcatcttgcc  c.1-541

.         .         .         .         .         .           g.5994
aggtgctggggttggaggcaagggagacagcctttgctcttgtgaaggcacttgtggtac  c.1-481

.         .         .         .         .         .           g.6054
agagtcaggggccaacaagcaaaccgtcaagttggtggttcctgagcattctctatgtct  c.1-421

.         .         .         .         .         .           g.6114
gggctgctgtggtgggcacacaagtgtaagacggttcctactcgccagtttggatgcaga  c.1-361

.         .         .         .         .         .           g.6174
ggcaggaaggaatgaggtgtgtgttagctcccagctgcttcaggaggcagggatgtgagg  c.1-301

.         .         .         .         .         .           g.6234
cccagcgggcctggagggaaggcagcgttttcctcctgtcttgggcctgggactgctgtc  c.1-241

.         .         .         .         .         .           g.6294
tgtggaaaggtgcccacaggtcccagctcacagcgattgttacccttgggcctggcactg  c.1-181

.         .         .         .         .         .           g.6354
gccaggggttttttcgggggccagaagtccatgttcaaaggggaaaagggggtcacgagg  c.1-121

.         .         .         .         .         .           g.6414
atcaatcttttctcctgctttaaagaaatgtttttgctactgcatgccctgatagtcgcc  c.1-61

.         .         .         .         .         .           g.6474
acaccagcagccgcctacctgggcagcaatgaccagctcacgtctcttgcttctttgcag  c.1-1


Powered by LOVD v.2.0 Build 28
©2004-2010 Leiden University Medical Center