von Willebrand factor (VWF) - downstream reference sequence


         .         .            .         .         .         . g.180836
agctcttatcttgcaaaaggc / tgctggtgcactgtgtcgtagggctgagatggcaacggt c.*180

         .         .         .         .         .         .    g.180896
gggcaggggctgagttctgagaccggttctgaggaaggaagcacaggccccatctgcaag    c.*240

         .         .         .         .         .         .    g.180956
cctcagtgtcagtgtgagatactgccaacttctggggaagagtgatgtctttgcctccag    c.*300

         .         .         .         .         .         .    g.181016
gggtgggaaaggcatagcatggggtaggcctcttctgaaactcagcacaaagtaaaaggg    c.*360

         .         .         .         .         .         .    g.181076
attttcccagcaacactggattctccagtctctgaatggaggggcttctgaacatagcag    c.*420

         .         .         .         .         .         .    g.181136
aggggtgggtcctggagccaggctcctgctgagatagatactattgttgtcacatggctg    c.*480

         .         .         .         .         .         .    g.181196
gcagtgtggagaaggtgtctgaccaggtgtgcaaggatttctctgagcccgtggctcaca    c.*540

         .         .         .         .         .         .    g.181256
gggttcctgtgtacccatagtggcccctgtgggagggagaggtgctgacgactgatgggg    c.*600

         .         .         .         .         .         .    g.181316
acctggaaacagggtgctggcaggtgcagtagtgtggtcacccaactcagcctgaggcca    c.*660

         .         .         .         .         .         .    g.181376
tgagccccagatttggaggcagacctgggctccacacatggccctcgctcagctgtgtgg    c.*720

         .         .         .         .         .         .    g.181436
cctcaaacaagccccttggtggttctcagactcagtttcctcatctggaaaacaggagtg    c.*780

         .         .         .         .         .         .    g.181496
ttgttctcactcataaggtggtaaggataaacaacctcagcctaaaatagggcctgcaag    c.*840

         .         .         .         .         .         .    g.181556
tccttaggtaactgtaaattgctctgtaatcatgtaagaagtggcgagaataacaatggg    c.*900

         .         .         .         .         .         .    g.181616
gagatcaaggctttcggtagggaataagagactctaatgttaacagcagagcattagaga    c.*960

         .         .         .         .         .         .    g.181676
tttcctttgtggtgagggctggaccggctgggtttctatcaggctttatgcttgatgcca    c.*1020

         .         .         .         .         .         .    g.181736
aggtcctacatactccagacatccttcagtggaagaggaagtggtgtagataacaccaaa    c.*1080

         .         .         .         .         .         .    g.181796
catcatccagtccccaaatcactaactggtactgtcacttgcagttagagatggtccttc    c.*1140

         .         .         .         .         .         .    g.181856
cttaaaatgtatggaagaattttcatgtacatgctggcaagatggtggggactcttgctg    c.*1200

         .         .         .         .         .         .    g.181916
gggagaatacccatgagaaagaaggggatgtcctggattacaagaatttgatgaagaatt    c.*1260

         .         .         .         .         .         .    g.181976
gattttcattccaaatacttttgacacaggagagactcagctcattgaaagtactggata    c.*1320

         .         .         .         .         .         .    g.182036
atggaatcaaaagggacttagacatcatctagtccactgtccctcctccactcctttaca    c.*1380

         .         .         .         .         .         .    g.182096
agtgatgaaagcagctcagagaattcaagtgacttgccaaaggtcataactgctgggtgg    c.*1440

         .         .         .         .         .         .    g.182156
cagggccaggttcagaacccaggtgacttgacacctgcataagaactcccaggccacccc    c.*1500

         .         .         .         .         .         .    g.182216
atcagagccacaccatccctgttgcttacactcctcccgtgctgacatggggaccagtga    c.*1560

         .         .         .         .         .         .    g.182276
ctgctgcacccttaagttcccaccacttctgttactgcctgagcttaaccttaagagaag    c.*1620

         .         .         .         .         .         .    g.182336
ccacattacaggaaaatggcatagattatgctgagtaggcttggtggggagtttagtggg    c.*1680

         .         .         .         .         .         .    g.182396
gcagaaggaaggaagaatggatagaagttttatgtaactactcagtaattcaaaggttac    c.*1740

         .         .         .         .         .         .    g.182456
tgtctctccatccatcaccccactcccaactttgggtagcctctaaggtctctcttggta    c.*1800

         .         .         .         .         .         .    g.182516
ggaaaccagatccagggacagggaattaactgtcactcttctgactgatcgcctaacact    c.*1860

         .         .         .         .         .         .    g.182576
ctagctggggacaaggtgttattggaggcatcagctctggagaaattcagcaggaaggct    c.*1920

         .         .         .         .         .         .    g.182636
aggctaccactgcagcataggtggttgattttccaactgcctgtgtcttgctagcttgaa    c.*1980

         .         .         .         .         .         .    g.182696
cttctcatgtttactgatatgtcattttaccgtcaagaaaaaagctgaatcggaaaactg    c.*2040

         .         .         .         .         .         .    g.182756
catgttttgattattttaaaaaaacccaaaacgatggaagagagctgggtaaaaaggatg    c.*2100

         .         .         .         .                        g.182797
caagaagagaaacttgtggggctagtgtgtgcggagcggtg                       c.*2141


Powered by LOVD v.2.0 Build 28
©2004-2010 Leiden University Medical Center