von Willebrand factor (VWF) - coding DNA reference sequence

(used for mutation description)

(last modified October 8, 2010)


This file was created to facilitate the description of sequence variants in the VWF gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_009072.1, covering VWF transcript NM_000552.3.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                                                   .                g.5010
                                                   agctcacagc       c.-241

 .         .         .         .         .         .                g.5070
 tattgtggtgggaaagggagggtggttggtggatgtcacagcttgggctttatctccccc       c.-181

 .         .         .         .         .         .                g.5130
 agcagtggggactccacagcccctgggctacataacagcaagacagtccggagctgtagc       c.-121

 .         .         .         .         .         .                g.5190
 agacctgattgagcctttgcagcagctgagagcatggcctagggtgggcggcaccattgt       c.-61

 .         .         .         .         .         .                g.5250
 ccagcagctgagtttcccagggaccttggagatagccgcagccctcatttgcaggggaag       c.-1

  | 02       .         .         .         .         .      | 03  . g.8337
  | ATGATTCCTGCCAGATTTGCCGGGGTGCTGCTTGCTCTGGCCCTCATTTTGCCAG | GGACC c.60
  | M  I  P  A  R  F  A  G  V  L  L  A  L  A  L  I  L  P  G |   T   p.20

          .         .         .         .         .         .       g.8397
 CTTTGTGCAGAAGGAACTCGCGGCAGGTCATCCACGGCCCGATGCAGCCTTTTCGGAAGT       c.120
 L  C  A  E  G  T  R  G  R  S  S  T  A  R  C  S  L  F  G  S         p.40

          .         .         .         .         .         .       g.8457
 GACTTCGTCAACACCTTTGATGGGAGCATGTACAGCTTTGCGGGATACTGCAGTTACCTC       c.180
 D  F  V  N  T  F  D  G  S  M  Y  S  F  A  G  Y  C  S  Y  L         p.60

          .         .         .         . | 04       .         .    g.18722
 CTGGCAGGGGGCTGCCAGAAACGCTCCTTCTCGATTATTG | GGGACTTCCAGAATGGCAAG    c.240
 L  A  G  G  C  Q  K  R  S  F  S  I  I  G |   D  F  Q  N  G  K      p.80

          .         .         .         .         .         .       g.18782
 AGAGTGAGCCTCTCCGTGTATCTTGGGGAATTTTTTGACATCCATTTGTTTGTCAATGGT       c.300
 R  V  S  L  S  V  Y  L  G  E  F  F  D  I  H  L  F  V  N  G         p.100

          .         .    | 05    .         .         .         .    g.19125
 ACCGTGACACAGGGGGACCAAAG | AGTCTCCATGCCCTATGCCTCCAAAGGGCTGTATCTA    c.360
 T  V  T  Q  G  D  Q  R  |  V  S  M  P  Y  A  S  K  G  L  Y  L      p.120

          .         .         .         .         .         .       g.19185
 GAAACTGAGGCTGGGTACTACAAGCTGTCCGGTGAGGCCTATGGCTTTGTGGCCAGGATC       c.420
 E  T  E  A  G  Y  Y  K  L  S  G  E  A  Y  G  F  V  A  R  I         p.140

          .         .         .         .         .         .       g.19245
 GATGGCAGCGGCAACTTTCAAGTCCTGCTGTCAGACAGATACTTCAACAAGACCTGCGGG       c.480
 D  G  S  G  N  F  Q  V  L  L  S  D  R  Y  F  N  K  T  C  G         p.160

          .         .         .         .         .   | 06     .    g.34094
 CTGTGTGGCAACTTTAACATCTTTGCTGAAGATGACTTTATGACCCAAGAAG | GGACCTTG    c.540
 L  C  G  N  F  N  I  F  A  E  D  D  F  M  T  Q  E  G |   T  L      p.180

          .         .         .         .         .         .       g.34154
 ACCTCGGACCCTTATGACTTTGCCAACTCATGGGCTCTGAGCAGTGGAGAACAGTGGTGT       c.600
 T  S  D  P  Y  D  F  A  N  S  W  A  L  S  S  G  E  Q  W  C         p.200

          .         .         .         .         .        | 07.    g.54122
 GAACGGGCATCTCCTCCCAGCAGCTCATGCAACATCTCCTCTGGGGAAATGCAGAAG | GGC    c.660
 E  R  A  S  P  P  S  S  S  C  N  I  S  S  G  E  M  Q  K   | G      p.220

          .         .         .         .         .         .       g.54182
 CTGTGGGAGCAGTGCCAGCTTCTGAAGAGCACCTCGGTGTTTGCCCGCTGCCACCCTCTG       c.720
 L  W  E  Q  C  Q  L  L  K  S  T  S  V  F  A  R  C  H  P  L         p.240

          .         .         .         .         .         .       g.54242
 GTGGACCCCGAGCCTTTTGTGGCCCTGTGTGAGAAGACTTTGTGTGAGTGTGCTGGGGGG       c.780
 V  D  P  E  P  F  V  A  L  C  E  K  T  L  C  E  C  A  G  G         p.260

          .         .         .         .         .         .       g.54302
 CTGGAGTGCGCCTGCCCTGCCCTCCTGGAGTACGCCCGGACCTGTGCCCAGGAGGGAATG       c.840
 L  E  C  A  C  P  A  L  L  E  Y  A  R  T  C  A  Q  E  G  M         p.280

          .         .         .     | 08   .         .         .    g.55955
 GTGCTGTACGGCTGGACCGACCACAGCGCGTGCA | GCCCAGTGTGCCCTGCTGGTATGGAG    c.900
 V  L  Y  G  W  T  D  H  S  A  C  S |   P  V  C  P  A  G  M  E      p.300

          .         .         .         .         .         .       g.56015
 TATAGGCAGTGTGTGTCCCCTTGCGCCAGGACCTGCCAGAGCCTGCACATCAATGAAATG       c.960
 Y  R  Q  C  V  S  P  C  A  R  T  C  Q  S  L  H  I  N  E  M         p.320

          .         .         .        | 09.         .         .    g.57251
 TGTCAGGAGCGATGCGTGGATGGCTGCAGCTGCCCTG | AGGGACAGCTCCTGGATGAAGGC    c.1020
 C  Q  E  R  C  V  D  G  C  S  C  P  E |   G  Q  L  L  D  E  G      p.340

          .         .         .         .         .         .       g.57311
 CTCTGCGTGGAGAGCACCGAGTGTCCCTGCGTGCATTCCGGAAAGCGCTACCCTCCCGGC       c.1080
 L  C  V  E  S  T  E  C  P  C  V  H  S  G  K  R  Y  P  P  G         p.360

          .         .          | 10        .         .         .    g.58358
 ACCTCCCTCTCTCGAGACTGCAACACCTG | CATTTGCCGAAACAGCCAGTGGATCTGCAGC    c.1140
 T  S  L  S  R  D  C  N  T  C  |  I  C  R  N  S  Q  W  I  C  S      p.380

          .       | 11 .         .         .         .         .    g.64441
 AATGAAGAATGTCCAG | GGGAGTGCCTTGTCACAGGTCAATCACACTTCAAGAGCTTTGAC    c.1200
 N  E  E  C  P  G |   E  C  L  V  T  G  Q  S  H  F  K  S  F  D      p.400

          .         .         .         .         .         .       g.64501
 AACAGATACTTCACCTTCAGTGGGATCTGCCAGTACCTGCTGGCCCGGGATTGCCAGGAC       c.1260
 N  R  Y  F  T  F  S  G  I  C  Q  Y  L  L  A  R  D  C  Q  D         p.420

          .         .         .    | 12    .         .         .    g.65313
 CACTCCTTCTCCATTGTCATTGAGACTGTCCAG | TGTGCTGATGACCGCGACGCTGTGTGC    c.1320
 H  S  F  S  I  V  I  E  T  V  Q   | C  A  D  D  R  D  A  V  C      p.440

          .         .         .         .         .         .       g.65373
 ACCCGCTCCGTCACCGTCCGGCTGCCTGGCCTGCACAACAGCCTTGTGAAACTGAAGCAT       c.1380
 T  R  S  V  T  V  R  L  P  G  L  H  N  S  L  V  K  L  K  H         p.460

          .         .         .         .         .   | 13     .    g.66624
 GGGGCAGGAGTTGCCATGGATGGCCAGGACGTCCAGCTCCCCCTCCTGAAAG | GTGACCTC    c.1440
 G  A  G  V  A  M  D  G  Q  D  V  Q  L  P  L  L  K  G |   D  L      p.480

          .         .         .         .         .         .       g.66684
 CGCATCCAGCATACAGTGACGGCCTCCGTGCGCCTCAGCTACGGGGAGGACCTGCAGATG       c.1500
 R  I  Q  H  T  V  T  A  S  V  R  L  S  Y  G  E  D  L  Q  M         p.500

          .         .         .    | 14    .         .         .    g.71653
 GACTGGGATGGCCGCGGGAGGCTGCTGGTGAAG | CTGTCCCCCGTCTATGCCGGGAAGACC    c.1560
 D  W  D  G  R  G  R  L  L  V  K   | L  S  P  V  Y  A  G  K  T      p.520

          .         .         .         .         .         .       g.71713
 TGCGGCCTGTGTGGGAATTACAATGGCAACCAGGGCGACGACTTCCTTACCCCCTCTGGG       c.1620
 C  G  L  C  G  N  Y  N  G  N  Q  G  D  D  F  L  T  P  S  G         p.540

          .         .         .         .         .         .       g.71773
 CTGGCGGAGCCCCGGGTGGAGGACTTCGGGAACGCCTGGAAGCTGCACGGGGACTGCCAG       c.1680
 L  A  E  P  R  V  E  D  F  G  N  A  W  K  L  H  G  D  C  Q         p.560

          .         .         .         .          | 15        .    g.72609
 GACCTGCAGAAGCAGCACAGCGATCCCTGCGCCCTCAACCCGCGCATGA | CCAGGTTCTCC    c.1740
 D  L  Q  K  Q  H  S  D  P  C  A  L  N  P  R  M  T |   R  F  S      p.580

          .         .         .         .         .         .       g.72669
 GAGGAGGCGTGCGCGGTCCTGACGTCCCCCACATTCGAGGCCTGCCATCGTGCCGTCAGC       c.1800
 E  E  A  C  A  V  L  T  S  P  T  F  E  A  C  H  R  A  V  S         p.600

          .         .         .         .         .         .       g.72729
 CCGCTGCCCTACCTGCGGAACTGCCGCTACGACGTGTGCTCCTGCTCGGACGGCCGCGAG       c.1860
 P  L  P  Y  L  R  N  C  R  Y  D  V  C  S  C  S  D  G  R  E         p.620

          .         .         .         .         .         .       g.72789
 TGCCTGTGCGGCGCCCTGGCCAGCTATGCCGCGGCCTGCGCGGGGAGAGGCGTGCGCGTC       c.1920
 C  L  C  G  A  L  A  S  Y  A  A  A  C  A  G  R  G  V  R  V         p.640

          .         .      | 16  .         .         .         .    g.76922
 GCGTGGCGCGAGCCAGGCCGCTGTG | AGCTGAACTGCCCGAAAGGCCAGGTGTACCTGCAG    c.1980
 A  W  R  E  P  G  R  C  E |   L  N  C  P  K  G  Q  V  Y  L  Q      p.660

          .         .         .         .         .         .       g.76982
 TGCGGGACCCCCTGCAACCTGACCTGCCGCTCTCTCTCTTACCCGGATGAGGAATGCAAT       c.2040
 C  G  T  P  C  N  L  T  C  R  S  L  S  Y  P  D  E  E  C  N         p.680

          .         .         .         .         .         .       g.77042
 GAGGCCTGCCTGGAGGGCTGCTTCTGCCCCCCAGGGCTCTACATGGATGAGAGGGGGGAC       c.2100
 E  A  C  L  E  G  C  F  C  P  P  G  L  Y  M  D  E  R  G  D         p.700

          .         .         .         .         .         .       g.77102
 TGCGTGCCCAAGGCCCAGTGCCCCTGTTACTATGACGGTGAGATCTTCCAGCCAGAAGAC       c.2160
 C  V  P  K  A  Q  C  P  C  Y  Y  D  G  E  I  F  Q  P  E  D         p.720

          .         .       | 17 .         .         .         .    g.82887
 ATCTTCTCAGACCATCACACCATGTG | CTACTGTGAGGATGGCTTCATGCACTGTACCATG    c.2220
 I  F  S  D  H  H  T  M  C  |  Y  C  E  D  G  F  M  H  C  T  M      p.740

          .         .         .         .         .         .       g.82947
 AGTGGAGTCCCCGGAAGCTTGCTGCCTGACGCTGTCCTCAGCAGTCCCCTGTCTCATCGC       c.2280
 S  G  V  P  G  S  L  L  P  D  A  V  L  S  S  P  L  S  H  R         p.760

   | 18      .         .         .         .         .         .    g.85278
 A | GCAAAAGGAGCCTATCCTGTCGGCCCCCCATGGTCAAGCTGGTGTGTCCCGCTGACAAC    c.2340
 S |   K  R  S  L  S  C  R  P  P  M  V  K  L  V  C  P  A  D  N      p.780

          .         .         .         .         .         .       g.85338
 CTGCGGGCTGAAGGGCTCGAGTGTACCAAAACGTGCCAGAACTATGACCTGGAGTGCATG       c.2400
 L  R  A  E  G  L  E  C  T  K  T  C  Q  N  Y  D  L  E  C  M         p.800

          .         .         .         .   | 19     .         .    g.93197
 AGCATGGGCTGTGTCTCTGGCTGCCTCTGCCCCCCGGGCATG | GTCCGGCATGAGAACAGA    c.2460
 S  M  G  C  V  S  G  C  L  C  P  P  G  M   | V  R  H  E  N  R      p.820

          .         .         .         .         .         .       g.93257
 TGTGTGGCCCTGGAAAGGTGTCCCTGCTTCCATCAGGGCAAGGAGTATGCCCCTGGAGAA       c.2520
 C  V  A  L  E  R  C  P  C  F  H  Q  G  K  E  Y  A  P  G  E         p.840

          .         .       | 20 .         .         .         .    g.94878
 ACAGTGAAGATTGGCTGCAACACTTG | TGTCTGTCGGGACCGGAAGTGGAACTGCACAGAC    c.2580
 T  V  K  I  G  C  N  T  C  |  V  C  R  D  R  K  W  N  C  T  D      p.860

          .         .         .         .         .         .       g.94938
 CATGTGTGTGATGCCACGTGCTCCACGATCGGCATGGCCCACTACCTCACCTTCGACGGG       c.2640
 H  V  C  D  A  T  C  S  T  I  G  M  A  H  Y  L  T  F  D  G         p.880

          .         .         .         .      | 21  .         .    g.98107
 CTCAAATACCTGTTCCCCGGGGAGTGCCAGTACGTTCTGGTGCAG | GATTACTGCGGCAGT    c.2700
 L  K  Y  L  F  P  G  E  C  Q  Y  V  L  V  Q   | D  Y  C  G  S      p.900

          .         .         .         .         .         .       g.98167
 AACCCTGGGACCTTTCGGATCCTAGTGGGGAATAAGGGATGCAGCCACCCCTCAGTGAAA       c.2760
 N  P  G  T  F  R  I  L  V  G  N  K  G  C  S  H  P  S  V  K         p.920

          .         .         .         .         .         .       g.98227
 TGCAAGAAACGGGTCACCATCCTGGTGGAGGGAGGAGAGATTGAGCTGTTTGACGGGGAG       c.2820
 C  K  K  R  V  T  I  L  V  E  G  G  E  I  E  L  F  D  G  E         p.940

  | 22       .         .         .         .         .         .    g.100242
  | GTGAATGTGAAGAGGCCCATGAAGGATGAGACTCACTTTGAGGTGGTGGAGTCTGGCCGG    c.2880
  | V  N  V  K  R  P  M  K  D  E  T  H  F  E  V  V  E  S  G  R      p.960

          .         .         .         .         .         .       g.100302
 TACATCATTCTGCTGCTGGGCAAAGCCCTCTCCGTGGTCTGGGACCGCCACCTGAGCATC       c.2940
 Y  I  I  L  L  L  G  K  A  L  S  V  V  W  D  R  H  L  S  I         p.980

          .         .        | 23.         .         .         .    g.103657
 TCCGTGGTCCTGAAGCAGACATACCAG | GAGAAAGTGTGTGGCCTGTGTGGGAATTTTGAT    c.3000
 S  V  V  L  K  Q  T  Y  Q   | E  K  V  C  G  L  C  G  N  F  D      p.1000

          .         .         .         .         .         .       g.103717
 GGCATCCAGAACAATGACCTCACCAGCAGCAACCTCCAAGTGGAGGAAGACCCTGTGGAC       c.3060
 G  I  Q  N  N  D  L  T  S  S  N  L  Q  V  E  E  D  P  V  D         p.1020

          .         .         .         .         | 24         .    g.103989
 TTTGGGAACTCCTGGAAAGTGAGCTCGCAGTGTGCTGACACCAGAAAA | GTGCCTCTGGAC    c.3120
 F  G  N  S  W  K  V  S  S  Q  C  A  D  T  R  K   | V  P  L  D      p.1040

          .         .         .         .         .         .       g.104049
 TCATCCCCTGCCACCTGCCATAACAACATCATGAAGCAGACGATGGTGGATTCCTCCTGT       c.3180
 S  S  P  A  T  C  H  N  N  I  M  K  Q  T  M  V  D  S  S  C         p.1060

          .         .         .         .   | 25     .         .    g.105901
 AGAATCCTTACCAGTGACGTCTTCCAGGACTGCAACAAGCTG | GTGGACCCCGAGCCATAT    c.3240
 R  I  L  T  S  D  V  F  Q  D  C  N  K  L   | V  D  P  E  P  Y      p.1080

          .         .         .         .         .         .       g.105961
 CTGGATGTCTGCATTTACGACACCTGCTCCTGTGAGTCCATTGGGGACTGCGCCTGCTTC       c.3300
 L  D  V  C  I  Y  D  T  C  S  C  E  S  I  G  D  C  A  C  F         p.1100

          .         .         .         .         .         .       g.106021
 TGCGACACCATTGCTGCCTATGCCCACGTGTGTGCCCAGCATGGCAAGGTGGTGACCTGG       c.3360
 C  D  T  I  A  A  Y  A  H  V  C  A  Q  H  G  K  V  V  T  W         p.1120

          .          | 26        .         .         .         .    g.106813
 AGGACGGCCACATTGTGCC | CCCAGAGCTGCGAGGAGAGGAATCTCCGGGAGAACGGGTAT    c.3420
 R  T  A  T  L  C  P |   Q  S  C  E  E  R  N  L  R  E  N  G  Y      p.1140

          .         .         .         .         .         .       g.106873
 GAGTGTGAGTGGCGCTATAACAGCTGTGCACCTGCCTGTCAAGTCACGTGTCAGCACCCT       c.3480
 E  C  E  W  R  Y  N  S  C  A  P  A  C  Q  V  T  C  Q  H  P         p.1160

          .         .         .         .         .         | 27    g.107637
 GAGCCACTGGCCTGCCCTGTGCAGTGTGTGGAGGGCTGCCATGCCCACTGCCCTCCAG | GG    c.3540
 E  P  L  A  C  P  V  Q  C  V  E  G  C  H  A  H  C  P  P  G |       p.1180

          .         .         .         .         .         .       g.107697
 AAAATCCTGGATGAGCTTTTGCAGACCTGCGTTGACCCTGAAGACTGTCCAGTGTGTGAG       c.3600
 K  I  L  D  E  L  L  Q  T  C  V  D  P  E  D  C  P  V  C  E         p.1200

          .         .         .         .         .         .       g.107757
 GTGGCTGGCCGGCGTTTTGCCTCAGGAAAGAAAGTCACCTTGAATCCCAGTGACCCTGAG       c.3660
 V  A  G  R  R  F  A  S  G  K  K  V  T  L  N  P  S  D  P  E         p.1220

          .     | 28   .         .         .         .         .    g.109973
 CACTGCCAGATTTG | CCACTGTGATGTTGTCAACCTCACCTGTGAAGCCTGCCAGGAGCCG    c.3720
 H  C  Q  I  C  |  H  C  D  V  V  N  L  T  C  E  A  C  Q  E  P      p.1240

          .         .         .         .         .         .       g.110033
 GGAGGCCTGGTGGTGCCTCCCACAGATGCCCCGGTGAGCCCCACCACTCTGTATGTGGAG       c.3780
 G  G  L  V  V  P  P  T  D  A  P  V  S  P  T  T  L  Y  V  E         p.1260

          .         .         .         .         .         .       g.110093
 GACATCTCGGAACCGCCGTTGCACGATTTCTACTGCAGCAGGCTACTGGACCTGGTCTTC       c.3840
 D  I  S  E  P  P  L  H  D  F  Y  C  S  R  L  L  D  L  V  F         p.1280

          .         .         .         .         .         .       g.110153
 CTGCTGGATGGCTCCTCCAGGCTGTCCGAGGCTGAGTTTGAAGTGCTGAAGGCCTTTGTG       c.3900
 L  L  D  G  S  S  R  L  S  E  A  E  F  E  V  L  K  A  F  V         p.1300

          .         .         .         .         .         .       g.110213
 GTGGACATGATGGAGCGGCTGCGCATCTCCCAGAAGTGGGTCCGCGTGGCCGTGGTGGAG       c.3960
 V  D  M  M  E  R  L  R  I  S  Q  K  W  V  R  V  A  V  V  E         p.1320

          .         .         .         .         .         .       g.110273
 TACCACGACGGCTCCCACGCCTACATCGGGCTCAAGGACCGGAAGCGACCGTCAGAGCTG       c.4020
 Y  H  D  G  S  H  A  Y  I  G  L  K  D  R  K  R  P  S  E  L         p.1340

          .         .         .         .         .         .       g.110333
 CGGCGCATTGCCAGCCAGGTGAAGTATGCGGGCAGCCAGGTGGCCTCCACCAGCGAGGTC       c.4080
 R  R  I  A  S  Q  V  K  Y  A  G  S  Q  V  A  S  T  S  E  V         p.1360

          .         .         .         .         .         .       g.110393
 TTGAAATACACACTGTTCCAAATCTTCAGCAAGATCGACCGCCCTGAAGCCTCCCGCATC       c.4140
 L  K  Y  T  L  F  Q  I  F  S  K  I  D  R  P  E  A  S  R  I         p.1380

          .         .         .         .         .         .       g.110453
 ACCCTGCTCCTGATGGCCAGCCAGGAGCCCCAACGGATGTCCCGGAACTTTGTCCGCTAC       c.4200
 T  L  L  L  M  A  S  Q  E  P  Q  R  M  S  R  N  F  V  R  Y         p.1400

          .         .         .         .         .         .       g.110513
 GTCCAGGGCCTGAAGAAGAAGAAGGTCATTGTGATCCCGGTGGGCATTGGGCCCCATGCC       c.4260
 V  Q  G  L  K  K  K  K  V  I  V  I  P  V  G  I  G  P  H  A         p.1420

          .         .         .         .         .         .       g.110573
 AACCTCAAGCAGATCCGCCTCATCGAGAAGCAGGCCCCTGAGAACAAGGCCTTCGTGCTG       c.4320
 N  L  K  Q  I  R  L  I  E  K  Q  A  P  E  N  K  A  F  V  L         p.1440

          .         .         .         .         .         .       g.110633
 AGCAGTGTGGATGAGCTGGAGCAGCAAAGGGACGAGATCGTTAGCTACCTCTGTGACCTT       c.4380
 S  S  V  D  E  L  E  Q  Q  R  D  E  I  V  S  Y  L  C  D  L         p.1460

          .         .         .         .         .         .       g.110693
 GCCCCTGAAGCCCCTCCTCCTACTCTGCCCCCCGACATGGCACAAGTCACTGTGGGCCCG       c.4440
 A  P  E  A  P  P  P  T  L  P  P  D  M  A  Q  V  T  V  G  P         p.1480

          .         .         .         .         .         .       g.110753
 GGGCTCTTGGGGGTTTCGACCCTGGGGCCCAAGAGGAACTCCATGGTTCTGGATGTGGCG       c.4500
 G  L  L  G  V  S  T  L  G  P  K  R  N  S  M  V  L  D  V  A         p.1500

          .         .         .         .         .         .       g.110813
 TTCGTCCTGGAAGGATCGGACAAAATTGGTGAAGCCGACTTCAACAGGAGCAAGGAGTTC       c.4560
 F  V  L  E  G  S  D  K  I  G  E  A  D  F  N  R  S  K  E  F         p.1520

          .         .         .         .         .         .       g.110873
 ATGGAGGAGGTGATTCAGCGGATGGATGTGGGCCAGGACAGCATCCACGTCACGGTGCTG       c.4620
 M  E  E  V  I  Q  R  M  D  V  G  Q  D  S  I  H  V  T  V  L         p.1540

          .         .         .         .         .         .       g.110933
 CAGTACTCCTACATGGTGACTGTGGAGTACCCCTTCAGCGAGGCACAGTCCAAAGGGGAC       c.4680
 Q  Y  S  Y  M  V  T  V  E  Y  P  F  S  E  A  Q  S  K  G  D         p.1560

          .         .         .         .         .         .       g.110993
 ATCCTGCAGCGGGTGCGAGAGATCCGCTACCAGGGCGGCAACAGGACCAACACTGGGCTG       c.4740
 I  L  Q  R  V  R  E  I  R  Y  Q  G  G  N  R  T  N  T  G  L         p.1580

          .         .         .         .         .         .       g.111053
 GCCCTGCGGTACCTCTCTGACCACAGCTTCTTGGTCAGCCAGGGTGACCGGGAGCAGGCG       c.4800
 A  L  R  Y  L  S  D  H  S  F  L  V  S  Q  G  D  R  E  Q  A         p.1600

          .         .         .         .         .         .       g.111113
 CCCAACCTGGTCTACATGGTCACCGGAAATCCTGCCTCTGATGAGATCAAGAGGCTGCCT       c.4860
 P  N  L  V  Y  M  V  T  G  N  P  A  S  D  E  I  K  R  L  P         p.1620

          .         .         .         .         .         .       g.111173
 GGAGACATCCAGGTGGTGCCCATTGGAGTGGGCCCTAATGCCAACGTGCAGGAGCTGGAG       c.4920
 G  D  I  Q  V  V  P  I  G  V  G  P  N  A  N  V  Q  E  L  E         p.1640

          .         .         .         .         .         .       g.111233
 AGGATTGGCTGGCCCAATGCCCCTATCCTCATCCAGGACTTTGAGACGCTCCCCCGAGAG       c.4980
 R  I  G  W  P  N  A  P  I  L  I  Q  D  F  E  T  L  P  R  E         p.1660

          .         .         .         .         .         .       g.111293
 GCTCCTGACCTGGTGCTGCAGAGGTGCTGCTCCGGAGAGGGGCTGCAGATCCCCACCCTC       c.5040
 A  P  D  L  V  L  Q  R  C  C  S  G  E  G  L  Q  I  P  T  L         p.1680

          .    | 29    .         .         .         .         .    g.112847
 TCCCCTGCACCTG | ACTGCAGCCAGCCCCTGGACGTGATCCTTCTCCTGGATGGCTCCTCC    c.5100
 S  P  A  P  D |   C  S  Q  P  L  D  V  I  L  L  L  D  G  S  S      p.1700

          .         .         .         .         .         .       g.112907
 AGTTTCCCAGCTTCTTATTTTGATGAAATGAAGAGTTTCGCCAAGGCTTTCATTTCAAAA       c.5160
 S  F  P  A  S  Y  F  D  E  M  K  S  F  A  K  A  F  I  S  K         p.1720

          . | 30       .         .         .         .         .    g.113064
 GCCAATATAG | GGCCTCGTCTCACTCAGGTGTCAGTGCTGCAGTATGGAAGCATCACCACC    c.5220
 A  N  I  G |   P  R  L  T  Q  V  S  V  L  Q  Y  G  S  I  T  T      p.1740

          .         .         .         .         .         .       g.113124
 ATTGACGTGCCATGGAACGTGGTCCCGGAGAAAGCCCATTTGCTGAGCCTTGTGGACGTC       c.5280
 I  D  V  P  W  N  V  V  P  E  K  A  H  L  L  S  L  V  D  V         p.1760

          .         .         .  | 31      .         .         .    g.113467
 ATGCAGCGGGAGGGAGGCCCCAGCCAAATCG | GGGATGCCTTGGGCTTTGCTGTGCGATAC    c.5340
 M  Q  R  E  G  G  P  S  Q  I  G |   D  A  L  G  F  A  V  R  Y      p.1780

          .         .         .         .         .         .       g.113527
 TTGACTTCAGAAATGCATGGTGCCAGGCCGGGAGCCTCAAAGGCGGTGGTCATCCTGGTC       c.5400
 L  T  S  E  M  H  G  A  R  P  G  A  S  K  A  V  V  I  L  V         p.1800

          .         .         .         .         .      | 32  .    g.116030
 ACGGACGTCTCTGTGGATTCAGTGGATGCAGCAGCTGATGCCGCCAGGTCCAACA | GAGTG    c.5460
 T  D  V  S  V  D  S  V  D  A  A  A  D  A  A  R  S  N  R |   V      p.1820

          .         .         .         .         .         .       g.116090
 ACAGTGTTCCCTATTGGAATTGGAGATCGCTACGATGCAGCCCAGCTACGGATCTTGGCA       c.5520
 T  V  F  P  I  G  I  G  D  R  Y  D  A  A  Q  L  R  I  L  A         p.1840

          .         .         .         .         .         .       g.116150
 GGCCCAGCAGGCGACTCCAACGTGGTGAAGCTCCAGCGAATCGAAGACCTCCCTACCATG       c.5580
 G  P  A  G  D  S  N  V  V  K  L  Q  R  I  E  D  L  P  T  M         p.1860

          .         .         .         . | 33       .         .    g.117560
 GTCACCTTGGGCAATTCCTTCCTCCACAAACTGTGCTCTG | GATTTGTTAGGATTTGCATG    c.5640
 V  T  L  G  N  S  F  L  H  K  L  C  S  G |   F  V  R  I  C  M      p.1880

          .         .     | 34   .         .         .         .    g.117912
 GATGAGGATGGGAATGAGAAGAGG | CCCGGGGACGTCTGGACCTTGCCAGACCAGTGCCAC    c.5700
 D  E  D  G  N  E  K  R   | P  G  D  V  W  T  L  P  D  Q  C  H      p.1900

          .         .         .         .         .         .       g.117972
 ACCGTGACTTGCCAGCCAGATGGCCAGACCTTGCTGAAGAGTCATCGGGTCAACTGTGAC       c.5760
 T  V  T  C  Q  P  D  G  Q  T  L  L  K  S  H  R  V  N  C  D         p.1920

          .         .         .         .         .         .       g.118032
 CGGGGGCTGAGGCCTTCGTGCCCTAACAGCCAGTCCCCTGTTAAAGTGGAAGAGACCTGT       c.5820
 R  G  L  R  P  S  C  P  N  S  Q  S  P  V  K  V  E  E  T  C         p.1940

          .         .   | 35     .         .         .         .    g.133486
 GGCTGCCGCTGGACCTGCCCCT | GCGTGTGCACAGGCAGCTCCACTCGGCACATCGTGACC    c.5880
 G  C  R  W  T  C  P  C |   V  C  T  G  S  S  T  R  H  I  V  T      p.1960

          .         .         .         .         .         .       g.133546
 TTTGATGGGCAGAATTTCAAGCTGACTGGCAGCTGTTCTTATGTCCTATTTCAAAACAAG       c.5940
 F  D  G  Q  N  F  K  L  T  G  S  C  S  Y  V  L  F  Q  N  K         p.1980

          .         .         .         .         .         .       g.133606
 GAGCAGGACCTGGAGGTGATTCTCCATAATGGTGCCTGCAGCCCTGGAGCAAGGCAGGGC       c.6000
 E  Q  D  L  E  V  I  L  H  N  G  A  C  S  P  G  A  R  Q  G         p.2000

          .         .         .         .         .         .       g.133666
 TGCATGAAATCCATCGAGGTGAAGCACAGTGCCCTCTCCGTCGAGCTGCACAGTGACATG       c.6060
 C  M  K  S  I  E  V  K  H  S  A  L  S  V  E  L  H  S  D  M         p.2020

     | 36    .         .         .         .         .         .    g.135120
 GAG | GTGACGGTGAATGGGAGACTGGTCTCTGTTCCTTACGTGGGTGGGAACATGGAAGTC    c.6120
 E   | V  T  V  N  G  R  L  V  S  V  P  Y  V  G  G  N  M  E  V      p.2040

          .         .         .         .         .         .       g.135180
 AACGTTTATGGTGCCATCATGCATGAGGTCAGATTCAATCACCTTGGTCACATCTTCACA       c.6180
 N  V  Y  G  A  I  M  H  E  V  R  F  N  H  L  G  H  I  F  T         p.2060

          .         .         .         .         .         .       g.135240
 TTCACTCCACAAAACAATGAGTTCCAACTGCAGCTCAGCCCCAAGACTTTTGCTTCAAAG       c.6240
 F  T  P  Q  N  N  E  F  Q  L  Q  L  S  P  K  T  F  A  S  K         p.2080

          .       | 37 .         .         .         .         .    g.135511
 ACGTATGGTCTGTGTG | GGATCTGTGATGAGAACGGAGCCAATGACTTCATGCTGAGGGAT    c.6300
 T  Y  G  L  C  G |   I  C  D  E  N  G  A  N  D  F  M  L  R  D      p.2100

          .         .         .         .         .         .       g.135571
 GGCACAGTCACCACAGACTGGAAAACACTTGTTCAGGAATGGACTGTGCAGCGGCCAGGG       c.6360
 G  T  V  T  T  D  W  K  T  L  V  Q  E  W  T  V  Q  R  P  G         p.2120

          .         .         .         .         .         .       g.135631
 CAGACGTGCCAGCCCATCCTGGAGGAGCAGTGTCTTGTCCCCGACAGCTCCCACTGCCAG       c.6420
 Q  T  C  Q  P  I  L  E  E  Q  C  L  V  P  D  S  S  H  C  Q         p.2140

          .         .         .         .         .         .       g.135691
 GTCCTCCTCTTACCACTGTTTGCTGAATGCCACAAGGTCCTGGCTCCAGCCACATTCTAT       c.6480
 V  L  L  L  P  L  F  A  E  C  H  K  V  L  A  P  A  T  F  Y         p.2160

          .         .         .         .         .         .       g.135751
 GCCATCTGCCAGCAGGACAGTTGCCACCAGGAGCAAGTGTGTGAGGTGATCGCCTCTTAT       c.6540
 A  I  C  Q  Q  D  S  C  H  Q  E  Q  V  C  E  V  I  A  S  Y         p.2180

          .         .         .         .         .         | 38    g.137654
 GCCCACCTCTGTCGGACCAACGGGGTCTGCGTTGACTGGAGGACACCTGATTTCTGTG | CT    c.6600
 A  H  L  C  R  T  N  G  V  C  V  D  W  R  T  P  D  F  C  A |       p.2200

          .         .         .         .         .         .       g.137714
 ATGTCATGCCCACCATCTCTGGTCTACAACCACTGTGAGCATGGCTGTCCCCGGCACTGT       c.6660
 M  S  C  P  P  S  L  V  Y  N  H  C  E  H  G  C  P  R  H  C         p.2220

          .         .         .         .         .         .       g.137774
 GATGGCAACGTGAGCTCCTGTGGGGACCATCCCTCCGAAGGCTGTTTCTGCCCTCCAGAT       c.6720
 D  G  N  V  S  S  C  G  D  H  P  S  E  G  C  F  C  P  P  D         p.2240

          .         .         .         .         .         .       g.137834
 AAAGTCATGTTGGAAGGCAGCTGTGTCCCTGAAGAGGCCTGCACTCAGTGCATTGGTGAG       c.6780
 K  V  M  L  E  G  S  C  V  P  E  E  A  C  T  Q  C  I  G  E         p.2260

          .         | 39         .         .         .         .    g.144047
 GATGGAGTCCAGCACCAG | TTCCTGGAAGCCTGGGTCCCGGACCACCAGCCCTGTCAGATC    c.6840
 D  G  V  Q  H  Q   | F  L  E  A  W  V  P  D  H  Q  P  C  Q  I      p.2280

          .         .         .         .         .         .       g.144107
 TGCACATGCCTCAGCGGGCGGAAGGTCAACTGCACAACGCAGCCCTGCCCCACGGCCAAA       c.6900
 C  T  C  L  S  G  R  K  V  N  C  T  T  Q  P  C  P  T  A  K         p.2300

   | 40      .         .         .         .         .         .    g.144610
 G | CTCCCACGTGTGGCCTGTGTGAAGTAGCCCGCCTCCGCCAGAATGCAGACCAGTGCTGC    c.6960
 A |   P  T  C  G  L  C  E  V  A  R  L  R  Q  N  A  D  Q  C  C      p.2320

          .       | 41 .         .         .         .         .    g.146460
 CCCGAGTATGAGTGTG | TGTGTGACCCAGTGAGCTGTGACCTGCCCCCAGTGCCTCACTGT    c.7020
 P  E  Y  E  C  V |   C  D  P  V  S  C  D  L  P  P  V  P  H  C      p.2340

          .         .         .         .         .         .       g.146520
 GAACGTGGCCTCCAGCCCACACTGACCAACCCTGGCGAGTGCAGACCCAACTTCACCTGC       c.7080
 E  R  G  L  Q  P  T  L  T  N  P  G  E  C  R  P  N  F  T  C         p.2360

   | 42      .         .         .         .         .         .    g.147738
 G | CCTGCAGGAAGGAGGAGTGCAAAAGAGTGTCCCCACCCTCCTGCCCCCCGCACCGTTTG    c.7140
 A |   C  R  K  E  E  C  K  R  V  S  P  P  S  C  P  P  H  R  L      p.2380

          .         .         .         .         .         .       g.147798
 CCCACCCTTCGGAAGACCCAGTGCTGTGATGAGTATGAGTGTGCCTGCAACTGTGTCAAC       c.7200
 P  T  L  R  K  T  Q  C  C  D  E  Y  E  C  A  C  N  C  V  N         p.2400

          .         .         .         .         .         .       g.147858
 TCCACAGTGAGCTGTCCCCTTGGGTACTTGGCCTCAACTGCCACCAATGACTGTGGCTGT       c.7260
 S  T  V  S  C  P  L  G  Y  L  A  S  T  A  T  N  D  C  G  C         p.2420

          .         .        | 43.         .         .         .    g.153443
 ACCACAACCACCTGCCTTCCCGACAAG | GTGTGTGTCCACCGAAGCACCATCTACCCTGTG    c.7320
 T  T  T  T  C  L  P  D  K   | V  C  V  H  R  S  T  I  Y  P  V      p.2440

          .         .         .         .         .         .       g.153503
 GGCCAGTTCTGGGAGGAGGGCTGCGATGTGTGCACCTGCACCGACATGGAGGATGCCGTG       c.7380
 G  Q  F  W  E  E  G  C  D  V  C  T  C  T  D  M  E  D  A  V         p.2460

          .         .         .         .         .        | 44.    g.157964
 ATGGGCCTCCGCGTGGCCCAGTGCTCCCAGAAGCCCTGTGAGGACAGCTGTCGGTCG | GGC    c.7440
 M  G  L  R  V  A  Q  C  S  Q  K  P  C  E  D  S  C  R  S   | G      p.2480

          .         .         .         .         .         .       g.158024
 TTCACTTACGTTCTGCATGAAGGCGAGTGCTGTGGAAGGTGCCTGCCATCTGCCTGTGAG       c.7500
 F  T  Y  V  L  H  E  G  E  C  C  G  R  C  L  P  S  A  C  E         p.2500

          .         .         .         .         | 45         .    g.160291
 GTGGTGACTGGCTCACCGCGGGGGGACTCCCAGTCTTCCTGGAAGAGT | GTCGGCTCCCAG    c.7560
 V  V  T  G  S  P  R  G  D  S  Q  S  S  W  K  S   | V  G  S  Q      p.2520

          .         .         .         .         .         .       g.160351
 TGGGCCTCCCCGGAGAACCCCTGCCTCATCAATGAGTGTGTCCGAGTGAAGGAGGAGGTC       c.7620
 W  A  S  P  E  N  P  C  L  I  N  E  C  V  R  V  K  E  E  V         p.2540

          .         .         .         .         .         .       g.160411
 TTTATACAACAAAGGAACGTCTCCTGCCCCCAGCTGGAGGTCCCTGTCTGCCCCTCGGGC       c.7680
 F  I  Q  Q  R  N  V  S  C  P  Q  L  E  V  P  V  C  P  S  G         p.2560

          .         .         .         .          | 46        .    g.161514
 TTTCAGCTGAGCTGTAAGACCTCAGCGTGCTGCCCAAGCTGTCGCTGTG | AGCGCATGGAG    c.7740
 F  Q  L  S  C  K  T  S  A  C  C  P  S  C  R  C  E |   R  M  E      p.2580

          .         .         . | 47       .         .         .    g.162098
 GCCTGCATGCTCAATGGCACTGTCATTGGG | CCCGGGAAGACTGTGATGATCGATGTGTGC    c.7800
 A  C  M  L  N  G  T  V  I  G   | P  G  K  T  V  M  I  D  V  C      p.2600

          .         .         .         .         .         .       g.162158
 ACGACCTGCCGCTGCATGGTGCAGGTGGGGGTCATCTCTGGATTCAAGCTGGAGTGCAGG       c.7860
 T  T  C  R  C  M  V  Q  V  G  V  I  S  G  F  K  L  E  C  R         p.2620

          .         .        | 48.         .         .         .    g.176109
 AAGACCACCTGCAACCCCTGCCCCCTG | GGTTACAAGGAAGAAAATAACACAGGTGAATGT    c.7920
 K  T  T  C  N  P  C  P  L   | G  Y  K  E  E  N  N  T  G  E  C      p.2640

          .         .         .         .         .         .       g.176169
 TGTGGGAGATGTTTGCCTACGGCTTGCACCATTCAGCTAAGAGGAGGACAGATCATGACA       c.7980
 C  G  R  C  L  P  T  A  C  T  I  Q  L  R  G  G  Q  I  M  T         p.2660

        | 49 .         .         .         .         .         .    g.177205
 CTGAAG | CGTGATGAGACGCTCCAGGATGGCTGTGATACTCACTTCTGCAAGGTCAATGAG    c.8040
 L  K   | R  D  E  T  L  Q  D  G  C  D  T  H  F  C  K  V  N  E      p.2680

          .         .         .         .         .         .       g.177265
 AGAGGAGAGTACTTCTGGGAGAAGAGGGTCACAGGCTGCCCACCCTTTGATGAACACAAG       c.8100
 R  G  E  Y  F  W  E  K  R  V  T  G  C  P  P  F  D  E  H  K         p.2700

          .      | 50  .         .         .         .      | 51  . g.179792
 TGTCTGGCTGAGGGA | GGTAAAATTATGAAAATTCCAGGCACCTGCTGTGACACAT | GTGAG c.8160
 C  L  A  E  G   | G  K  I  M  K  I  P  G  T  C  C  D  T  C |   E   p.2720

          .         .         .         .         .         .       g.179852
 GAGCCTGAGTGCAACGACATCACTGCCAGGCTGCAGTATGTCAAGGTGGGAAGCTGTAAG       c.8220
 E  P  E  C  N  D  I  T  A  R  L  Q  Y  V  K  V  G  S  C  K         p.2740

          .         .         .    | 52    .         .         .    g.180494
 TCTGAAGTAGAGGTGGATATCCACTACTGCCAG | GGCAAATGTGCCAGCAAAGCCATGTAC    c.8280
 S  E  V  E  V  D  I  H  Y  C  Q   | G  K  C  A  S  K  A  M  Y      p.2760

          .         .         .         .         .         .       g.180554
 TCCATTGACATCAACGATGTGCAGGACCAGTGCTCCTGCTGCTCTCCGACACGGACGGAG       c.8340
 S  I  D  I  N  D  V  Q  D  Q  C  S  C  C  S  P  T  R  T  E         p.2780

          .         .         .         .         .         .       g.180614
 CCCATGCAGGTGGCCCTGCACTGCACCAATGGCTCTGTTGTGTACCATGAGGTTCTCAAT       c.8400
 P  M  Q  V  A  L  H  C  T  N  G  S  V  V  Y  H  E  V  L  N         p.2800

          .         .         .         .                           g.180656
 GCCATGGAGTGCAAATGCTCCCCCAGGAAGTGCAGCAAGTGA                         c.8442
 A  M  E  C  K  C  S  P  R  K  C  S  K  X                           p.2813

          .         .         .         .         .         .       g.180716
 ggctgctgcagctgcatgggtgcctgctgctgcctgccttggcctgatggccaggccaga       c.*60

          .         .         .         .         .         .       g.180776
 gtgctgccagtcctctgcatgttctgctcttgtgcccttctgagcccacaataaaggctg       c.*120

          .         .                                               g.180797
 agctcttatcttgcaaaaggc                                              c.*141

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Von Willebrand factor protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.2.0 Build 28
©2004-2010 Leiden University Medical Center