Glycoprotein Ib (platelet), alpha polypeptide (GP1BA) - coding DNA reference sequence

(used for mutation description)

(last modified November 22, 2012)


This file was created to facilitate the description of sequence variants in the GP1BA gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_008767.2, covering GP1BA transcript NM_000173.5.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                                                   .                g.5017
                                              gagagaaggacggag       c.-61

 .         .         .         .         .         .    | 02        g.5310
 tcgagtggcaccctagaagacgctctgtgccttcggaggtctttctgcctgcct | gtcctc    c.-1

          .         .         .         .         .         .       g.5370
 ATGCCTCTCCTCCTCTTGCTGCTCCTGCTGCCAAGCCCCTTACACCCCCACCCCATCTGT       c.60
 M  P  L  L  L  L  L  L  L  L  P  S  P  L  H  P  H  P  I  C         p.20

          .         .         .         .         .         .       g.5430
 GAGGTCTCCAAAGTGGCCAGCCACCTAGAAGTGAACTGTGACAAGAGGAATCTGACAGCG       c.120
 E  V  S  K  V  A  S  H  L  E  V  N  C  D  K  R  N  L  T  A         p.40

          .         .         .         .         .         .       g.5490
 CTGCCTCCAGACCTGCCGAAAGACACAACCATCCTCCACCTGAGTGAGAACCTCCTGTAC       c.180
 L  P  P  D  L  P  K  D  T  T  I  L  H  L  S  E  N  L  L  Y         p.60

          .         .         .         .         .         .       g.5550
 ACCTTCTCCCTGGCAACCCTGATGCCTTACACTCGCCTCACTCAGCTGAACCTAGATAGG       c.240
 T  F  S  L  A  T  L  M  P  Y  T  R  L  T  Q  L  N  L  D  R         p.80

          .         .         .         .         .         .       g.5610
 TGCGAGCTCACCAAGCTCCAGGTCGATGGGACGCTGCCAGTGCTGGGGACCCTGGATCTA       c.300
 C  E  L  T  K  L  Q  V  D  G  T  L  P  V  L  G  T  L  D  L         p.100

          .         .         .         .         .         .       g.5670
 TCCCACAATCAGCTGCAAAGCCTGCCCTTGCTAGGGCAGACACTGCCTGCTCTCACCGTC       c.360
 S  H  N  Q  L  Q  S  L  P  L  L  G  Q  T  L  P  A  L  T  V         p.120

          .         .         .         .         .         .       g.5730
 CTGGACGTCTCCTTCAACCGGCTGACCTCGCTGCCTCTTGGTGCCCTGCGTGGTCTTGGC       c.420
 L  D  V  S  F  N  R  L  T  S  L  P  L  G  A  L  R  G  L  G         p.140

          .         .         .         .         .         .       g.5790
 GAACTCCAAGAGCTCTACCTGAAAGGCAATGAGCTGAAGACCCTGCCCCCAGGGCTCCTG       c.480
 E  L  Q  E  L  Y  L  K  G  N  E  L  K  T  L  P  P  G  L  L         p.160

          .         .         .         .         .         .       g.5850
 ACGCCCACACCCAAGCTGGAGAAGCTCAGTCTGGCTAACAACAACTTGACTGAGCTCCCC       c.540
 T  P  T  P  K  L  E  K  L  S  L  A  N  N  N  L  T  E  L  P         p.180

          .         .         .         .         .         .       g.5910
 GCTGGGCTCCTGAATGGGCTGGAGAATCTCGACACCCTTCTCCTCCAAGAGAACTCGCTG       c.600
 A  G  L  L  N  G  L  E  N  L  D  T  L  L  L  Q  E  N  S  L         p.200

          .         .         .         .         .         .       g.5970
 TATACAATACCAAAGGGCTTTTTTGGGTCCCACCTCCTGCCTTTTGCTTTTCTCCACGGG       c.660
 Y  T  I  P  K  G  F  F  G  S  H  L  L  P  F  A  F  L  H  G         p.220

          .         .         .         .         .         .       g.6030
 AACCCCTGGTTATGCAACTGTGAGATCCTCTATTTTCGTCGCTGGCTGCAGGACAATGCT       c.720
 N  P  W  L  C  N  C  E  I  L  Y  F  R  R  W  L  Q  D  N  A         p.240

          .         .         .         .         .         .       g.6090
 GAAAATGTCTACGTATGGAAGCAAGGTGTGGACGTCAAGGCCATGACCTCTAACGTGGCC       c.780
 E  N  V  Y  V  W  K  Q  G  V  D  V  K  A  M  T  S  N  V  A         p.260

          .         .         .         .         .         .       g.6150
 AGTGTGCAGTGTGACAATTCAGACAAGTTTCCCGTCTACAAATACCCAGGAAAGGGGTGC       c.840
 S  V  Q  C  D  N  S  D  K  F  P  V  Y  K  Y  P  G  K  G  C         p.280

          .         .         .         .         .         .       g.6210
 CCCACCCTTGGTGATGAAGGTGACACAGACCTATATGATTACTACCCAGAAGAGGACACT       c.900
 P  T  L  G  D  E  G  D  T  D  L  Y  D  Y  Y  P  E  E  D  T         p.300

          .         .         .         .         .         .       g.6270
 GAGGGCGATAAGGTGCGTGCCACAAGGACTGTGGTCAAGTTCCCCACCAAAGCCCATACA       c.960
 E  G  D  K  V  R  A  T  R  T  V  V  K  F  P  T  K  A  H  T         p.320

          .         .         .         .         .         .       g.6330
 ACCCCCTGGGGTCTATTCTACTCATGGTCCACTGCTTCTCTAGACAGCCAAATGCCCTCC       c.1020
 T  P  W  G  L  F  Y  S  W  S  T  A  S  L  D  S  Q  M  P  S         p.340

          .         .         .         .         .         .       g.6390
 TCCTTGCATCCAACACAAGAATCCACTAAGGAGCAGACCACATTCCCACCTAGATGGACC       c.1080
 S  L  H  P  T  Q  E  S  T  K  E  Q  T  T  F  P  P  R  W  T         p.360

          .         .         .         .         .         .       g.6450
 CCAAATTTCACACTTCACATGGAATCCATCACATTCTCCAAAACTCCAAAATCCACTACT       c.1140
 P  N  F  T  L  H  M  E  S  I  T  F  S  K  T  P  K  S  T  T         p.380

          .         .         .         .         .         .       g.6510
 GAACCAACCCCAAGCCCGACCACCTCAGAGCCCGTCCCGGAGCCCGCCCCAAACATGACC       c.1200
 E  P  T  P  S  P  T  T  S  E  P  V  P  E  P  A  P  N  M  T         p.400

          .         .         .         .         .         .       g.6570
 ACCCTGGAGCCCACTCCAAGCCCGACCACCCCAGAGCCCACCTCAGAGCCCGCCCCCAGC       c.1260
 T  L  E  P  T  P  S  P  T  T  P  E  P  T  S  E  P  A  P  S         p.420

          .         .         .         .         .         .       g.6630
 CCGACCACCCCGGAGCCCACCTCAGAGCCCGCCCCCAGCCCGACCACCCCAGAGCCCACC       c.1320
 P  T  T  P  E  P  T  S  E  P  A  P  S  P  T  T  P  E  P  T         p.440

          .         .         .         .         .         .       g.6690
 TCAGAGCCCGCCCCCAGCCCGACCACCCCGGAGCCCACCCCAATCCCGACCATCGCCACA       c.1380
 S  E  P  A  P  S  P  T  T  P  E  P  T  P  I  P  T  I  A  T         p.460

          .         .         .         .         .         .       g.6750
 AGCCCGACCATCCTGGTGTCTGCCACAAGCCTGATCACTCCAAAAAGCACATTTTTAACT       c.1440
 S  P  T  I  L  V  S  A  T  S  L  I  T  P  K  S  T  F  L  T         p.480

          .         .         .         .         .         .       g.6810
 ACCACAAAACCCGTATCACTCTTAGAATCCACCAAAAAAACCATCCCTGAACTTGATCAG       c.1500
 T  T  K  P  V  S  L  L  E  S  T  K  K  T  I  P  E  L  D  Q         p.500

          .         .         .         .         .         .       g.6870
 CCACCAAAGCTCCGTGGGGTGCTCCAAGGGCATTTGGAGAGCTCCAGAAATGACCCTTTT       c.1560
 P  P  K  L  R  G  V  L  Q  G  H  L  E  S  S  R  N  D  P  F         p.520

          .         .         .         .         .         .       g.6930
 CTCCACCCCGACTTTTGCTGCCTCCTCCCCCTGGGCTTCTATGTCTTGGGTCTCTTCTGG       c.1620
 L  H  P  D  F  C  C  L  L  P  L  G  F  Y  V  L  G  L  F  W         p.540

          .         .         .         .         .         .       g.6990
 CTGCTCTTTGCCTCTGTGGTCCTCATCCTGCTGCTGAGCTGGGTTGGGCATGTGAAACCA       c.1680
 L  L  F  A  S  V  V  L  I  L  L  L  S  W  V  G  H  V  K  P         p.560

          .         .         .         .         .         .       g.7050
 CAGGCCCTGGACTCTGGCCAAGGTGCTGCTCTGACCACAGCCACACAAACCACACACCTG       c.1740
 Q  A  L  D  S  G  Q  G  A  A  L  T  T  A  T  Q  T  T  H  L         p.580

          .         .         .         .         .         .       g.7110
 GAGCTGCAGAGGGGACGGCAAGTGACAGTGCCCCGGGCCTGGCTGCTCTTCCTTCGAGGT       c.1800
 E  L  Q  R  G  R  Q  V  T  V  P  R  A  W  L  L  F  L  R  G         p.600

          .         .         .         .         .         .       g.7170
 TCGCTTCCCACTTTCCGCTCCAGCCTCTTCCTGTGGGTACGGCCTAATGGCCGTGTGGGG       c.1860
 S  L  P  T  F  R  S  S  L  F  L  W  V  R  P  N  G  R  V  G         p.620

          .         .         .         .         .         .       g.7230
 CCTCTAGTGGCAGGAAGGAGGCCCTCAGCTCTGAGTCAGGGTCGTGGTCAGGACCTGCTG       c.1920
 P  L  V  A  G  R  R  P  S  A  L  S  Q  G  R  G  Q  D  L  L         p.640

          .         .         .                                     g.7269
 AGCACAGTGAGCATTAGGTACTCTGGCCACAGCCTCTGA                            c.1959
 S  T  V  S  I  R  Y  S  G  H  S  L  X                              p.652

          .         .         .         .         .         .       g.7329
 gggtgggaggtttggggaccttgagagaagagcctgtgggctctcctattggaatctagt       c.*60

          .         .         .         .         .         .       g.7389
 tgggggttggaggggtaaggaacacagggtgatagggaggggtcttagttcctttttctg       c.*120

          .         .         .         .         .         .       g.7449
 tatcagaagccctgtcttcacaacacaggcacacaatttcagtcccagccaaagcagaag       c.*180

          .         .         .         .         .         .       g.7509
 gggtaatgacatggacttggcggggggacaagacaaagctcccgatgctgcatggggcgc       c.*240

          .         .         .         .         .         .       g.7569
 tgccagatctcacggtgaaccattttggcagaatacagcatggttcccacatgcatctat       c.*300

          .         .         .         .         .         .       g.7629
 gcacagaagaaaatctggaaagtgatttatcaggatgtgagcactcgttgtgtctggatg       c.*360

          .         .         .         .         .         .       g.7689
 ttacaaatatgggtggttttattttctttttccctgtttagcattttctagttttccact       c.*420

          .         .         .         .                           g.7736
 attattgtatattatctgtataataaaaaataattttagggttggga                    c.*467

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Glycoprotein Ib (platelet), alpha polypeptide protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.2.0 Build 34
©2004-2012 Leiden University Medical Center