paired box 2 (PAX2) - coding DNA reference sequence

(used for mutation description)

(last modified June 17, 2011)


This file was created to facilitate the description of sequence variants in the PAX2 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_008680.1, covering PAX2 transcript NM_003990.3.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                                                   .                g.5010
                                                   cgggggcctg       c.-541

 .         .         .         .         .         .                g.5070
 gcccgcgcgctcccctcccgcaggcgccacctcggacatccccgggattgctacttctct       c.-481

 .         .         .         .         .         .                g.5130
 gccaacttcgccaactcgccagcacttggagaggcccggctcccctcccggcgccctctg       c.-421

 .         .         .         .         .         .                g.5190
 accgcccccgccccgcgcgctctccgaccaccgcctctcggatgaccaggttccagggga       c.-361

 .         .         .         .         .         .                g.5250
 gctgagcgagtcgcctcccccgcccagcttcagccctggctgcagctgcagcgcgagcca       c.-301

 .         .         .         .         .         .                g.5310
 tgcgcccccagtgcaccccggcccggcccaccgccccggggccattctgctgaccgccca       c.-241

 .         .         .         .         .         .                g.5370
 gccccgagccccgacagtggcaagttgcggctactgcagttgcaagctccggccaacccg       c.-181

 .         .         .         .         .         .                g.5430
 gaggagccccagcggggagcgcagtgctgcgccccccgcccccgcgcgccccgcagcagc       c.-121

 .         .         .         .         .         .                g.5490
 cgggcgttcactcatcctccctcccccaccgtccctcccttttctcctcaagtcctgaag       c.-61

 .         .         .         .         .         .                g.5550
 ttgagtttgagaggcgacacggcggcggcggccgcgctgctcccgctcctctgcctcccc       c.-1

          .         .         .         .    | 02    .         .    g.9052
 ATGGATATGCACTGCAAAGCAGACCCCTTCTCCGCGATGCACC | CAGGGCACGGGGGTGTG    c.60
 M  D  M  H  C  K  A  D  P  F  S  A  M  H  P |   G  H  G  G  V      p.20

          .         .         .         .         .         .       g.9112
 AACCAGCTCGGGGGGGTGTTTGTGAACGGCCGGCCCCTACCCGACGTGGTGAGGCAGCGC       c.120
 N  Q  L  G  G  V  F  V  N  G  R  P  L  P  D  V  V  R  Q  R         p.40

          .         .         .         .         .         .       g.9172
 ATCGTGGAGCTGGCCCACCAGGGTGTGCGGCCCTGTGACATCTCCCGGCAGCTGCGGGTC       c.180
 I  V  E  L  A  H  Q  G  V  R  P  C  D  I  S  R  Q  L  R  V         p.60

          .         .         .   | 03     .         .         .    g.10011
 AGCCACGGCTGTGTCAGCAAAATCCTGGGCAG | GTACTACGAGACCGGCAGCATCAAGCCG    c.240
 S  H  G  C  V  S  K  I  L  G  R  |  Y  Y  E  T  G  S  I  K  P      p.80

          .         .         .         .         .         .       g.10071
 GGTGTGATCGGTGGCTCCAAGCCCAAAGTGGCGACGCCCAAAGTGGTGGACAAGATTGCT       c.300
 G  V  I  G  G  S  K  P  K  V  A  T  P  K  V  V  D  K  I  A         p.100

          .         .         .         .         .         .       g.10131
 GAATACAAACGACAGAACCCGACTATGTTCGCCTGGGAGATTCGAGACCGGCTCCTGGCC       c.360
 E  Y  K  R  Q  N  P  T  M  F  A  W  E  I  R  D  R  L  L  A         p.120

          .         .         .         .         . | 04       .    g.38797
 GAGGGCATCTGTGACAATGACACAGTGCCCAGCGTCTCTTCCATCAACAG | AATCATCCGG    c.420
 E  G  I  C  D  N  D  T  V  P  S  V  S  S  I  N  R  |  I  I  R      p.140

          .         .         .         .         .         .       g.38857
 ACCAAAGTTCAGCAGCCTTTCCACCCAACGCCGGATGGGGCTGGGACAGGAGTGACCGCC       c.480
 T  K  V  Q  Q  P  F  H  P  T  P  D  G  A  G  T  G  V  T  A         p.160

          .       | 05 .         .         .         .         .    g.40579
 CCTGGCCACACCATTG | TTCCCAGCACGGCCTCCCCTCCTGTTTCCAGCGCCTCCAATGAC    c.540
 P  G  H  T  I  V |   P  S  T  A  S  P  P  V  S  S  A  S  N  D      p.180

          .         .         .         .         .         .       g.40639
 CCAGTGGGATCCTACTCCATCAATGGGATCCTGGGGATTCCTCGCTCCAATGGTGAGAAG       c.600
 P  V  G  S  Y  S  I  N  G  I  L  G  I  P  R  S  N  G  E  K         p.200

          .       | 06 .         .         .         .         .    g.46276
 AGGAAACGTGATGAAG | TTGAGGTATACACTGATCCTGCCCACATTAGAGGAGGTGGAGGT    c.660
 R  K  R  D  E  V |   E  V  Y  T  D  P  A  H  I  R  G  G  G  G      p.220

          .         .      | 07  .         .         .         .    g.65754
 TTGCATCTGGTCTGGACTTTAAGAG | ATGTGTCTGAGGGCTCAGTCCCCAATGGAGATTCC    c.720
 L  H  L  V  W  T  L  R  D |   V  S  E  G  S  V  P  N  G  D  S      p.240

          .         .         .         .         .         .       g.65814
 CAGAGTGGTGTGGACAGTTTGCGGAAGCACTTGCGAGCTGACACCTTCACCCAGCAGCAG       c.780
 Q  S  G  V  D  S  L  R  K  H  L  R  A  D  T  F  T  Q  Q  Q         p.260

          .         .         .         .         .         .       g.65874
 CTGGAAGCTTTGGATCGGGTCTTTGAGCGTCCTTCCTACCCTGACGTCTTCCAGGCATCA       c.840
 L  E  A  L  D  R  V  F  E  R  P  S  Y  P  D  V  F  Q  A  S         p.280

          .         .  | 08      .         .         .         .    g.68438
 GAGCACATCAAATCAGAACAG | GGGAACGAGTACTCCCTCCCAGCCCTGACCCCTGGGCTT    c.900
 E  H  I  K  S  E  Q   | G  N  E  Y  S  L  P  A  L  T  P  G  L      p.300

          .         .         .         .         .         .       g.68498
 GATGAAGTCAAGTCGAGTCTATCTGCATCCACCAACCCTGAGCTGGGCAGCAACGTGTCA       c.960
 D  E  V  K  S  S  L  S  A  S  T  N  P  E  L  G  S  N  V  S         p.320

          .         .         | 09         .         .         .    g.83969
 GGCACACAGACATACCCAGTTGTGACTG | GTCGTGACATGGCGAGCACCACTCTGCCTGGT    c.1020
 G  T  Q  T  Y  P  V  V  T  G |   R  D  M  A  S  T  T  L  P  G      p.340

          .         .         .         .         .         .       g.84029
 TACCCCCCTCACGTGCCCCCCACTGGCCAGGGAAGCTACCCCACCTCCACCCTGGCAGGA       c.1080
 Y  P  P  H  V  P  P  T  G  Q  G  S  Y  P  T  S  T  L  A  G         p.360

          . | 10       .         .         .         .         .    g.86348
 ATGGTGCCTG | GGAGCGAGTTCTCCGGCAACCCGTACAGCCACCCCCAGTACACGGCCTAC    c.1140
 M  V  P  G |   S  E  F  S  G  N  P  Y  S  H  P  Q  Y  T  A  Y      p.380

          .         .         .        | 11.         .         .    g.86874
 AACGAGGCTTGGAGATTCAGCAACCCCGCCTTACTAA | TGCCGCCCCCCGGTCCGCCCCTG    c.1200
 N  E  A  W  R  F  S  N  P  A  L  L  M |   P  P  P  G  P  P  L      p.400

          .         .         .         .         .         .       g.86934
 CCGCTGCTGCCGCTGCCTATGACCGCCACTAGTTACCGCGGGGACCACATCAAGCTTCAG       c.1260
 P  L  L  P  L  P  M  T  A  T  S  Y  R  G  D  H  I  K  L  Q         p.420

          .         .         .                                     g.86970
 GCCGACAGCTTCGGCCTCCACATCGTCCCCGTCTGA                               c.1296
 A  D  S  F  G  L  H  I  V  P  V  X                                 p.431

          .         .         .         .         .         .       g.87030
 ccccaccccggagggagggaggaccgacgcgacgcgatgcctcccggccaccgccccagc       c.*60

          .         .         .         .         .         .       g.87090
 ctcaccccatcccacgacccccgcaacccttcacatcacccccctcgaaggtcggacagg       c.*120

          .         .         .         .         .         .       g.87150
 acgggtggagccgtgggcgggaccctcaggcccgggcccgccgcccccagccccgcctgc       c.*180

          .         .         .         .         .         .       g.87210
 cgcccctccccgcctgcctggactgcgcggcgccgtgagggggattcggcccagctcgtc       c.*240

          .         .         .         .         .         .       g.87270
 ccggcctccaccaagccagccccgaagcccgccagccaccctgccggactcgggcgcgac       c.*300

          .         .         .         .         .         .       g.87330
 ctgctggcgcgcgccggatgtttctgtgacacacaatcagcgcggaccgcagcgcggccc       c.*360

          .         .         .         .         .         .       g.87390
 agccccgggcacccgcctcggacgctcgggcgccaggaggcttcgctggaggggctgggc       c.*420

          .         .         .         .         .         .       g.87450
 caaggagattaagaagaaaacgactttctgcaggaggaagagcccgctgccgaatccctg       c.*480

          .         .         .         .         .         .       g.87510
 ggaaaaattcttttcccccagtgccagccggactgccctcgccttccgggtgtgccctgt       c.*540

          .         .         .         .         .         .       g.87570
 cccagaagatggaatgggggtgtgggggtccggctctaggaacgggctttgggggcgtca       c.*600

          .         .         .         .         .         .       g.87630
 ggtctttccaaggttgggacccaaggatcggggggcccagcagcccgcaccgatcgagcc       c.*660

          .         .         .         .         .         .       g.87690
 ggactctcggctcttcactgctcctcctggcctgcctagttccccagggcccggcacctc       c.*720

          .         .         .         .         .         .       g.87750
 ctgctgcgagacccggctctcagccctgccttgcccctacctcagcgtctcttccacctg       c.*780

          .         .         .         .         .         .       g.87810
 ctggcctcccagtttcccctcctgccagtccttcgcctgtcccttgacgccctgcatcct       c.*840

          .         .         .         .         .         .       g.87870
 cctccctgactcgcagccccatcggacgctctcccgggaccgccgcaggaccagtttcca       c.*900

          .         .         .         .         .         .       g.87930
 tagactgcggactggggtcttcctccagcagttacttgatgccccctcccccgacacaga       c.*960

          .         .         .         .         .         .       g.87990
 ctctcaatctgccggtggtaagaaccggttctgagctggcgtctgagctgctgcggggtg       c.*1020

          .         .         .         .         .         .       g.88050
 gaagtggggggctgcccactccactcctcccatcccctcccagcctcctcctccggcagg       c.*1080

          .         .         .         .         .         .       g.88110
 aactgaacagaaccacaaaaagtctacatttatttaatatgatggtctttgcaaaaagga       c.*1140

          .         .         .         .         .         .       g.88170
 acaaaacaacacaaaagcccaccaggctgctgctttgtggaaagacggtgtgtgtcgtgt       c.*1200

          .         .         .         .         .         .       g.88230
 gaaggcgaaacccggtgtacataacccctccccctccgccccgccccgcccggccccgta       c.*1260

          .         .         .         .         .         .       g.88290
 gagtccctgtcgcccgccggccctgcctgtagatacgccccgctgtctgtgctgtgagag       c.*1320

          .         .         .         .         .         .       g.88350
 tcgccgctcgctgggggggaagggggggacacagctacacgcccattaaagcacagcacg       c.*1380

          .         .         .         .         .         .       g.88410
 tcctgggggaggggggcattttttatgttacaaaaaaaaattacgaaagaaaagaaatct       c.*1440

          .         .         .         .         .         .       g.88470
 ctatgcaaaatgacgaacatggtcctgtggactcctctggcctgttttgttggctctttc       c.*1500

          .         .         .         .         .         .       g.88530
 tctgtaattccgtgttttcgctttttcctccctgcccctctctccctctgcccctctctc       c.*1560

          .         .         .         .         .         .       g.88590
 ctctccgcttctctccccctctgtctctgtctctctccgtctctgtcgctcttgtctgtc       c.*1620

          .         .         .         .         .         .       g.88650
 tgtctctgctctttcctcggcctctctccccagacctggcccggccgccctgtctccgca       c.*1680

          .         .         .         .         .         .       g.88710
 ggctagatccgaggtggcagctccagcccccgggctcgccccctcgcgggcgtgccccgc       c.*1740

          .         .         .         .         .         .       g.88770
 gcgccccgggcggccgaaggccgggccgccccgtcccgccccgtagttgctctttcggta       c.*1800

          .         .         .         .         .         .       g.88830
 gtggcgatgcgccctgcatgtctcctcacccgtggatcgtgacgactcgaaataacagaa       c.*1860

          .         .         .         .         .         .       g.88890
 acaaagtcaataaagtgaaaataaataaaaatccttgaacaaatccgaaaaggcttggag       c.*1920

          .         .         .         .         .         .       g.88950
 tcctcgcccagatctctctcccctgcgagccctttttatttgagaaggaaaaagagaaaa       c.*1980

          .         .         .         .         .         .       g.89010
 gagaatcgtttaagggaacccggcgcccagccaggctccagtggcccgaacggggcggcg       c.*2040

          .         .         .         .         .         .       g.89070
 agggcggcgagggcgccgaggtccggcccatcccagtcctgtggggctggccgggcagag       c.*2100

          .         .         .         .         .         .       g.89130
 accccggacccaggcccaggcctaacctgctaaatgtccccggacggttctggtctcctc       c.*2160

          .         .         .         .         .         .       g.89190
 ggccactttcagtgcgtcggttcgttttgattctttttcttttgtgcacataagaaataa       c.*2220

          .         .         .                                     g.89228
 ataataataataaataaagaataaaattttgtatgtca                             c.*2258

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Paired box 2 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.2.0 Build 31
©2004-2011 Leiden University Medical Center