LOVD - Variant listings for ARSD

About this overview [Show]

14 entries
entries per page

Exon Hide Exon column Descending
Ascending

DNA change   Descending
Ascending

Var_pub_as Hide Var_pub_as column Descending
Ascending

RNA change Hide RNA change column Descending
Ascending

Protein Hide Protein column Descending
Ascending

DB-ID Hide DB-ID column Descending
Ascending

Variant remarks Hide Variant remarks column Descending
Ascending

Frequency Hide Frequency column Descending
Ascending

Reference Hide Reference column Descending
Ascending

Template Hide Template column Descending
Ascending

do not use Hide do not use column Descending
Ascending

Re-site Hide Re-site column Descending
Ascending

Genetic origin Hide Genetic origin column Descending
Ascending
5 c.693C>T p.T231T r.(?) p.(=) ARSD_00013 recurrent, found 2 times; for privacy reasons only summary data are given - for details contact Lucy Raymond (flr24 @ cam.ac.uk) - Tarpey 2009 DNA SEQ - -
5 c.701_730delCCGGCGTGGGCTGCCTGTTTTTCATCTCTT - r.(?) p.(A234_W244delinsG) ARSD_00014 recurrent, found 6 times; for privacy reasons only summary data are given - for details contact Lucy Raymond (flr24 @ cam.ac.uk) - Tarpey 2009 DNA SEQ - -
5 c.470C>T p.S157F r.(?) p.(Ser157Phe) ARSD_00002 recurrent, found 14 times; for privacy reasons only summary data are given - for details contact Lucy Raymond (flr24 @ cam.ac.uk) - Tarpey 2009 DNA SEQ - -
5 c.497T>A p.L166Q r.(?) p.(Leu166Gln) ARSD_00003 recurrent, found 16 times; for privacy reasons only summary data are given - for details contact Lucy Raymond (flr24 @ cam.ac.uk) - Tarpey 2009 DNA SEQ - -
5 c.524G>A p.G175D r.(?) p.(Gly175Asp) ARSD_00004 recurrent, found 45 times; for privacy reasons only summary data are given - for details contact Lucy Raymond (flr24 @ cam.ac.uk) - Tarpey 2009 DNA SEQ - -
5 c.527T>A p.M176K r.(?) p.(Met176Lys) ARSD_00005 recurrent, found 16 times; for privacy reasons only summary data are given - for details contact Lucy Raymond (flr24 @ cam.ac.uk) - Tarpey 2009 DNA SEQ - -
5 c.570C>T p.P190P r.(?) p.(=) ARSD_00006 recurrent, found 15 times; for privacy reasons only summary data are given - for details contact Lucy Raymond (flr24 @ cam.ac.uk) - Tarpey 2009 DNA SEQ - -
5 c.624G>C p.A208A r.(?) p.(=) ARSD_00007 recurrent, found 17 times; for privacy reasons only summary data are given - for details contact Lucy Raymond (flr24 @ cam.ac.uk) - Tarpey 2009 DNA SEQ - -
5 c.648C>T p.A216A r.(?) p.(=) ARSD_00008 recurrent, found 18 times; for privacy reasons only summary data are given - for details contact Lucy Raymond (flr24 @ cam.ac.uk) - Tarpey 2009 DNA SEQ - -
5 c.661G>A p.G221S r.(?) p.(Gly221Ser) ARSD_00009 recurrent, found 14 times; for privacy reasons only summary data are given - for details contact Lucy Raymond (flr24 @ cam.ac.uk) - Tarpey 2009 DNA SEQ - -
5 c.667T>A p.F223I r.(?) p.(Phe223Ile) ARSD_00010 recurrent, found 13 times; for privacy reasons only summary data are given - for details contact Lucy Raymond (flr24 @ cam.ac.uk) - Tarpey 2009 DNA SEQ - -
5 c.667T>C p.F223L r.(?) p.(Phe223Leu) ARSD_00011 recurrent, found 2 times; for privacy reasons only summary data are given - for details contact Lucy Raymond (flr24 @ cam.ac.uk) - Tarpey 2009 DNA SEQ - -
5 c.671C>G p.S224C r.(?) p.(Ser224Cys) ARSD_00012 recurrent, found 94 times; for privacy reasons only summary data are given - for details contact Lucy Raymond (flr24 @ cam.ac.uk) - Tarpey 2009 DNA SEQ - -
10 c.1691T>C p.M564T r.(?) p.(Met564Thr) ARSD_00001 recurrent, found 7 times; for privacy reasons only summary data are given - for details contact Lucy Raymond (flr24 @ cam.ac.uk) - Tarpey 2009 DNA SEQ - -
1 - 14

Legend: [ ARSD full legend ]
Sequence variations are described basically as recommended by the Ad-Hoc Committee for Mutation Nomenclature (AHCMN), with the recently suggested additions (den Dunnen JT and Antonarakis SE [2000], Hum.Mut. 15:7-12); for a summary see Nomenclature. Genomic Reference Sequence.
Exon: number of exon/intron containing variant; 2 = exon 2, 12i = intron 12, 2i_7i = exons 3 to 7, 8i_9 = border intron 8/exon 9 DNA change: Variation at DNA-level. If present, "Full Details" will show you the the full-length entry. Var_pub_as: What the variant was reported as. RNA change: Variation at RNA-level, (?) unknown but probably identical to DNA. Protein: Variation at protein level. ARSD DB-ID: BD-ID = database IDentifier Variant remarks: Variant remarks Frequency: Frequency if variant is non pathogenic. Reference: Reference = reference to publication describing variant Template: Detection_Template do not use: do not use Re-site: Variant creates (+) or destroys (-) a restriction enzyme recognition site. Genetic origin: origin of variant; unknown, germline (i.e. inherited), somatic, de novo, from parental disomy (maternal or paternal) or in vitro (cloned) when tested for functional consequences