LOVD - Variant listings for ARSD

About this overview [Show]

14 public entries
entries per page

Path. Hide Path. column Descending

Exon Hide Exon column Descending

DNA change   Descending

Var_pub_as Hide Var_pub_as column Descending

RNA change Hide RNA change column Descending

Protein Hide Protein column Descending

DB-ID Hide DB-ID column Descending

Variant remarks Hide Variant remarks column Descending

Frequency Hide Frequency column Descending

Reference Hide Reference column Descending

Template Hide Template column Descending

do not use Hide do not use column Descending

Re-site Hide Re-site column Descending

Genetic origin Hide Genetic origin column Descending

Disease Hide Disease column Descending

Phenotype additional Hide Phenotype additional column Descending

Remarks Hide Remarks column Descending

Reference Hide Reference column Descending

Geographic origin Hide Geographic origin column Descending

Ethnic origin Hide Ethnic origin column Descending

Inheritance Hide Inheritance column Descending

Consang. Hide Consang. column Descending

Age_exam Hide Age_exam column Descending

Age_onset Hide Age_onset column Descending

MR Hide MR column Descending

# Reported Hide # Reported column Descending
?/? 5 c.693C>T p.T231T r.(?) p.(=) ARSD_00013 recurrent, found 2 times; for privacy reasons only summary data are given - for details contact Lucy Raymond (flr24 @ cam.ac.uk) - Tarpey 2009 DNA SEQ - - MRX - - Raymond:Cambridge ? ? unknown - - - - 2
?/? 5 c.701_730delCCGGCGTGGGCTGCCTGTTTTTCATCTCTT - r.(?) p.(A234_W244delinsG) ARSD_00014 recurrent, found 6 times; for privacy reasons only summary data are given - for details contact Lucy Raymond (flr24 @ cam.ac.uk) - Tarpey 2009 DNA SEQ - - MRX - - Raymond:Cambridge ? ? unknown - - - - 6
?/? 5 c.470C>T p.S157F r.(?) p.(Ser157Phe) ARSD_00002 recurrent, found 14 times; for privacy reasons only summary data are given - for details contact Lucy Raymond (flr24 @ cam.ac.uk) - Tarpey 2009 DNA SEQ - - MRX - - Raymond:Cambridge ? ? unknown - - - - 14
?/? 5 c.497T>A p.L166Q r.(?) p.(Leu166Gln) ARSD_00003 recurrent, found 16 times; for privacy reasons only summary data are given - for details contact Lucy Raymond (flr24 @ cam.ac.uk) - Tarpey 2009 DNA SEQ - - MRX - - Raymond:Cambridge ? ? unknown - - - - 16
?/? 5 c.524G>A p.G175D r.(?) p.(Gly175Asp) ARSD_00004 recurrent, found 45 times; for privacy reasons only summary data are given - for details contact Lucy Raymond (flr24 @ cam.ac.uk) - Tarpey 2009 DNA SEQ - - MRX - - Raymond:Cambridge ? ? unknown - - - - 45
?/? 5 c.527T>A p.M176K r.(?) p.(Met176Lys) ARSD_00005 recurrent, found 16 times; for privacy reasons only summary data are given - for details contact Lucy Raymond (flr24 @ cam.ac.uk) - Tarpey 2009 DNA SEQ - - MRX - - Raymond:Cambridge ? ? unknown - - - - 16
?/? 5 c.570C>T p.P190P r.(?) p.(=) ARSD_00006 recurrent, found 15 times; for privacy reasons only summary data are given - for details contact Lucy Raymond (flr24 @ cam.ac.uk) - Tarpey 2009 DNA SEQ - - MRX - - Raymond:Cambridge ? ? unknown - - - - 15
?/? 5 c.624G>C p.A208A r.(?) p.(=) ARSD_00007 recurrent, found 17 times; for privacy reasons only summary data are given - for details contact Lucy Raymond (flr24 @ cam.ac.uk) - Tarpey 2009 DNA SEQ - - MRX - - Raymond:Cambridge ? ? unknown - - - - 17
?/? 5 c.648C>T p.A216A r.(?) p.(=) ARSD_00008 recurrent, found 18 times; for privacy reasons only summary data are given - for details contact Lucy Raymond (flr24 @ cam.ac.uk) - Tarpey 2009 DNA SEQ - - MRX - - Raymond:Cambridge ? ? unknown - - - - 18
?/? 5 c.661G>A p.G221S r.(?) p.(Gly221Ser) ARSD_00009 recurrent, found 14 times; for privacy reasons only summary data are given - for details contact Lucy Raymond (flr24 @ cam.ac.uk) - Tarpey 2009 DNA SEQ - - MRX - - Raymond:Cambridge ? ? unknown - - - - 14
?/? 5 c.667T>A p.F223I r.(?) p.(Phe223Ile) ARSD_00010 recurrent, found 13 times; for privacy reasons only summary data are given - for details contact Lucy Raymond (flr24 @ cam.ac.uk) - Tarpey 2009 DNA SEQ - - MRX - - Raymond:Cambridge ? ? unknown - - - - 13
?/? 5 c.667T>C p.F223L r.(?) p.(Phe223Leu) ARSD_00011 recurrent, found 2 times; for privacy reasons only summary data are given - for details contact Lucy Raymond (flr24 @ cam.ac.uk) - Tarpey 2009 DNA SEQ - - MRX - - Raymond:Cambridge ? ? unknown - - - - 2
?/? 5 c.671C>G p.S224C r.(?) p.(Ser224Cys) ARSD_00012 recurrent, found 94 times; for privacy reasons only summary data are given - for details contact Lucy Raymond (flr24 @ cam.ac.uk) - Tarpey 2009 DNA SEQ - - MRX - - Raymond:Cambridge ? ? unknown - - - - 94
?/? 10 c.1691T>C p.M564T r.(?) p.(Met564Thr) ARSD_00001 recurrent, found 7 times; for privacy reasons only summary data are given - for details contact Lucy Raymond (flr24 @ cam.ac.uk) - Tarpey 2009 DNA SEQ - - MRX - - Raymond:Cambridge ? ? unknown - - - - 7
1 - 14

Legend: [ ARSD full legend ]
Sequence variations are described basically as recommended by the Ad-Hoc Committee for Mutation Nomenclature (AHCMN), with the recently suggested additions (den Dunnen JT and Antonarakis SE [2000], Hum.Mut. 15:7-12); for a summary see Nomenclature. Genomic Reference Sequence.
Path.: Variant pathogenicity, in the format Reported/Concluded; '+' indicating the variant is pathogenic, '+?' probably pathogenic, '-' no known pathogenicity, '-?' probably no pathogenicity, '?' effect unknown. Exon: number of exon/intron containing variant; 2 = exon 2, 12i = intron 12, 2i_7i = exons 3 to 7, 8i_9 = border intron 8/exon 9 DNA change: Variation at DNA-level. If present, "Full Details" will show you the the full-length entry. Var_pub_as: What the variant was reported as. RNA change: Variation at RNA-level, (?) unknown but probably identical to DNA. Protein: Variation at protein level. ARSD DB-ID: BD-ID = database IDentifier Variant remarks: Variant remarks Frequency: Frequency if variant is non pathogenic. Reference: Reference = reference to publication describing variant Template: Detection_Template do not use: do not use Re-site: Variant creates (+) or destroys (-) a restriction enzyme recognition site. Genetic origin: origin of variant; unknown, germline (i.e. inherited), somatic, de novo, from parental disomy (maternal or paternal) or in vitro (cloned) when tested for functional consequences Disease: Disease phenotype, as reported in paper/by submitter, unless modified by the curator. Phenotype additional: Phenotype, additional features Remarks: Remarks Reference: Reference describing the phenotype Geographic origin: Geographic origin of patient Ethnic origin: Ethnic origin of patient Inheritance: indicates the inheritance of the phenotype in the family; unknown, familial (autosomal/X-linked, dominant/ recessive), paternal (Y-linked), maternal (mitochondrial) or isolated (sporadic) Consang.: indicates whether the parents are related (consanguineous), not related (non-consanguineous) or whether consanguinity is not known (unknown) Age_exam: age at which the individual was examined; 4y8m = 4 years and 8 months Age_onset: age at which the disease became evident; 4y8m = 4 years and 8 months MR: MR # Reported: Number of times this case has been reported