pericentrin (PCNT) - 1412 nt intron 43 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.122022
gtaaatgccatgacgttcagtcagtgcgttccgcgtctgtctccgtgagtgggcagcaca  c.9623+60

         .         .         .         .         .         .  g.122082
ctgcatggttttttggtcattttattccttgaaactccataatatgttctttttaaagat  c.9623+120

         .         .         .         .         .         .  g.122142
gaatggcatttgaggccttagagaaaatacagatgatgaacttgtcttcaagaagtcatg  c.9623+180

         .         .         .         .         .         .  g.122202
tgtatgaatctctcaccttctaaaactaaagatttaagggcacctttgtattacagagga  c.9623+240

         .         .         .         .         .         .  g.122262
acatcttgacttttaatgggtttcgtgccacaaagaacgtgctgaatttctaaaactgtt  c.9623+300

         .         .         .         .         .         .  g.122322
tttccccctaaacactgtgcggctgtgcctgctccctgatgccacagaggtgtttcccaa  c.9623+360

         .         .         .         .         .         .  g.122382
ggccacgcgcgggcctgtctggagtagcagatgcagcagagagcagctaggaatcccgct  c.9623+420

         .         .         .         .         .         .  g.122442
cctttcagagaccaggtgccgagccagttcagtcatcgcggctgcaggctgggccaaagt  c.9623+480

         .         .         .         .         .         .  g.122502
ggggtgcaggcgaggcctcctgggttgctgtactctcagcttctctggtcctggggcact  c.9623+540

         .         .         .         .         .         .  g.122562
ttgtctcctcgtctctgagctcccctgaccgtaggcctccaccgtccatccttccaccca  c.9623+600

         .         .         .         .         .         .  g.122622
cccatctgtccatcctgtgttcatggggagaacaccctgcaggaggaagcattttaggca  c.9623+660

         .         .         .         .        g.122668
ctagataggggaggtaagcagacccagatcctacctcctgtcgagg  c.9623+706

--------------------- middle of intron ---------------------
  g.122669          .         .         .         .           g.122714
  c.9624-706  aggggagatcttttgaaggcagtggtgtcccagaaaggagcagtct  c.9624-661

.         .         .         .         .         .           g.122774
ctgtgtccctgtgagggcactgcctagggtagctgccaccaaggggccttgacaggtctt  c.9624-601

.         .         .         .         .         .           g.122834
atggaggaatcggcagtgtctgctatgcctcaaaggagggaagccacaggcatgatgctt  c.9624-541

.         .         .         .         .         .           g.122894
gttccgaaggccatcctagcagggcgtctggggccctgcacactgacctgcatgccctcg  c.9624-481

.         .         .         .         .         .           g.122954
tcacctgcactctgcatgctcaccatctgacggactcctgcgagggctggggtctccgtg  c.9624-421

.         .         .         .         .         .           g.123014
ttctgagcctgtccagtggcatctgtgacaggatgaagatgggagggtcctgcacaccag  c.9624-361

.         .         .         .         .         .           g.123074
gcgggagcggcatgtgtttcctagtcactggtgtggccggctgactttgaactggagtcg  c.9624-301

.         .         .         .         .         .           g.123134
tcctgagctgggccatggtgggtgtctaggggaccatatggtccacggtggggccgcagt  c.9624-241

.         .         .         .         .         .           g.123194
gaggctttgtcaggtggttgggcatgggaaggtcgccgccgccggcagccctgcgagcac  c.9624-181

.         .         .         .         .         .           g.123254
tttggatgtgtgcacccggcatgccaggcccgagtcaacagactggccgaccttggcgtc  c.9624-121

.         .         .         .         .         .           g.123314
ctggtccccatgggcagcgaggcccccattctgcttgtttggtcacagtggggttttcat  c.9624-61

.         .         .         .         .         .           g.123374
tgctctttcccttcctgtcttgccgtacttttaagtgtgtcttgtctcttttttttgtag  c.9624-1


Powered by LOVD v.2.0 Build 25
©2004-2010 Leiden University Medical Center