pericentrin (PCNT) - 314 nt intron 18 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.69824
gtgagtgtgccgggaccagctgcccagccctgtgcttgcagcccctctgtggtcctggag  c.3607+60

         .         .         .         .         .         .  g.69884
ctctctgagaggagcctccgtattgggcgatgcccttgggagcactgccgtcctggtttc  c.3607+120

         .         .         .         g.69921
ctgctagtttccgcacttacagaaggccgagaccggg  c.3607+157

--------------------- middle of intron ---------------------
           g.69922            .         .         .           g.69958
           c.3608-157  gtttgggctaaatttgtcagctcccgtggacgtggcg  c.3608-121

.         .         .         .         .         .           g.70018
ctgactcatctcggctggggcgacgttctgagttctgtggcttccttgtcgtcttggctg  c.3608-61

.         .         .         .         .         .           g.70078
ccatggccgcggccggcttgctcactgagccgcgtgtgccggcatctgctcatcttgtag  c.3608-1


Powered by LOVD v.2.0 Build 25
©2004-2010 Leiden University Medical Center