pericentrin (PCNT) - 2758 nt intron 17 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.66923
gtcagtgtgtcctcggcaccgaggctgccttgtggccgccagcacccgctgggtcatgca  c.3464+60

         .         .         .         .         .         .  g.66983
gatgccattggtccccacggctcctggccccgtggctgctgccaccatgcacgctggctc  c.3464+120

         .         .         .         .         .         .  g.67043
ctggtggacggggacccggcttccttcttctctcagttagaaagattgtaagcaccggga  c.3464+180

         .         .         .         .         .         .  g.67103
agaaatcgcctgctgtgtctcatctcccagcccccgtgccctcctcccaccctgcctgct  c.3464+240

         .         .         .         .         .         .  g.67163
gtgtctcatttccccatctggccagattaaaaccagccgttatctcccacacagagcccg  c.3464+300

         .         .         .         .         .         .  g.67223
acccctcccctttagtgtctgcgtccccgcagcgtgtcctcgtccccggcacggggtgca  c.3464+360

         .         .         .         .         .         .  g.67283
ggcccacatgtctcgtggttcctgtgctttggactgtgtgcaagtgtcgtgcctcatgca  c.3464+420

         .         .         .         .         .         .  g.67343
tctctctctgtgacgtgtgtttctgagaccggcccaagcaggggccgtagccctgtccgt  c.3464+480

         .         .         .         .         .         .  g.67403
tcctttctccattgggagcctgtgcctgggtagctgcaggcactgggctgagcgcccagc  c.3464+540

         .         .         .         .         .         .  g.67463
cccgagggctctcccagggcggggtgtgggtctgcttaccacgggccgtggggccgcctt  c.3464+600

         .         .         .         .         .         .  g.67523
ccctgaacgcatgggtccaggccacatcctgccttggtgcctcctcacctgcagtgatgc  c.3464+660

         .         .         .         .         .         .  g.67583
tgtccagcaggcttgtctgcccttttgtcgcgtgtggggtcttgagaaactttttgctcc  c.3464+720

         .         .         .         .         .         .  g.67643
tctgacaccatggaggtttttcccaggtcacctcacagggttttaagttttgcttttgtg  c.3464+780

         .         .         .         .         .         .  g.67703
tgactctggggtgagcctgcagagttgttcttgcttgcacctgtctgggcagtggactcg  c.3464+840

         .         .         .         .         .         .  g.67763
gcactgtgttgccaaacgcagcctccccttggtgcgcgtcctccccgtccccttgtgtgg  c.3464+900

         .         .         .         .         .         .  g.67823
gtctttggctgctcccattggcgtgtccccgcccgaggcctctgtgtcctgctgctgctc  c.3464+960

         .         .         .         .         .         .  g.67883
ccatctgtgtgtccccgctgaggcttctgggtccagccactgctcccgtctgtctgtccc  c.3464+1020

         .         .         .         .         .         .  g.67943
cgccccaggcctctgagtcctgctgctgctcccgtctttgtgtccccactcgaggcctct  c.3464+1080

         .         .         .         .         .         .  g.68003
gggttgtgctgctgtgtcctgaagctctgaactggtttggctctgctctggagaccaccc  c.3464+1140

         .         .         .         .         .         .  g.68063
agggtccggagaccaggtcgggcttatgggaccctctgagctcacagctgtttctggagc  c.3464+1200

         .         .         .         .         .         .  g.68123
attggtgtctgtcatgctgagggtccatccgtgtgtggggggtgtctgtgcaggtctctc  c.3464+1260

         .         .         .         .         .         .  g.68183
tttgttcttttcatcaagttttgtgatttttctgtgaggaccttgccttctgtagcactt  c.3464+1320

         .         .         .         .         .           g.68242
ggctgtgggtgtctcgtagcttggtgctgactctctccagtcacccaggtcagtgggcg  c.3464+1379

--------------------- middle of intron ---------------------
          .         .         .         .         .           g.68301
 agcgagagctctaaaccgaggggcacagcggccagtggggcggtctgtgctcttaactc  c.3465-1321

.         .         .         .         .         .           g.68361
gaggggtgcagaggtgggtggtgggcggggtagtcccaggctctaaacacaaggggtgca  c.3465-1261

.         .         .         .         .         .           g.68421
gaggtgagcccacggtccctggacactggagaggctgcctgtcttgaggtggggtggctg  c.3465-1201

.         .         .         .         .         .           g.68481
cagacgccctgatgcctgcaggagttgggcattttggggggtggaagtgtgctggggagc  c.3465-1141

.         .         .         .         .         .           g.68541
aggtggcattctctccgtcaagcccctcctcaggactccccctccctgttatttgcccag  c.3465-1081

.         .         .         .         .         .           g.68601
aatcttcggtttcgcggggcctgcacgacactgcctcccgttgtcacctcacggtcccca  c.3465-1021

.         .         .         .         .         .           g.68661
cgaatgagtcctcatcgtctgctcctcagggttgggctctctggggacagagctgtgagc  c.3465-961

.         .         .         .         .         .           g.68721
agagtagagggagggctggctgtgtagtcactgggtcaacgtgcctgtcctcagcggcgt  c.3465-901

.         .         .         .         .         .           g.68781
cacagctcctaaatcatagtgcagggagcgagatgtggaggggcctgtggcctcgggagc  c.3465-841

.         .         .         .         .         .           g.68841
ccctgtgtgtaaaaacagaagcatcccagccgggcgcagtggctcacgcttgtaatccca  c.3465-781

.         .         .         .         .         .           g.68901
gcactttgggaggctgaggcgggtggatcatgaggtcaggagatcgagaccatcctggct  c.3465-721

.         .         .         .         .         .           g.68961
aacatggtgaaaccccatctctactaaaaatacaaaaaattagccgggcgtggtgacaga  c.3465-661

.         .         .         .         .         .           g.69021
cgcctgtagtcccagctactcgggaggctgaggcaggagaaaggcgtgaacccgggaggt  c.3465-601

.         .         .         .         .         .           g.69081
ggagcttgcagtgagccaagatcgtgccactgcactccagcctgggcgacagagcgagac  c.3465-541

.         .         .         .         .         .           g.69141
tccatctcaaaaaaaaaaaaagacagaagcatcccagaccgcacgtccacgaggcctagc  c.3465-481

.         .         .         .         .         .           g.69201
gagaggctgggagacaccatcctcttcctgccacacaactcctgtgaatgtgtggctgag  c.3465-421

.         .         .         .         .         .           g.69261
gcgtgacttggtgttggacagacatcttgtgaaatggctggctggtgcaccctgtgctcc  c.3465-361

.         .         .         .         .         .           g.69321
aggggaggggcggagcctgtgtgctgctcccgggtgattgacgctgtgcggccacatcgc  c.3465-301

.         .         .         .         .         .           g.69381
acacctgcgggacgggtttgccgtgttcctaatgtgatgccttttacacatcagaaatgg  c.3465-241

.         .         .         .         .         .           g.69441
catcaggaagacctcacctaggaaagcccgtgtccctgagtgggctccacgtggttgtct  c.3465-181

.         .         .         .         .         .           g.69501
tgtctgtggcctcagcttcctgtgctcacatgggcatgaggatcatgtcttccggccccg  c.3465-121

.         .         .         .         .         .           g.69561
tggggacaggcagccgtgggccgaggtgtgcaaactggtgggcggcccctcagcagcatc  c.3465-61

.         .         .         .         .         .           g.69621
cagggtgggggttcttatgccgtgaccagcttgcctgatgatgggtgtctcctgtctcag  c.3465-1


Powered by LOVD v.2.0 Build 25
©2004-2010 Leiden University Medical Center