pericentrin (PCNT) - coding DNA reference sequence

(used for mutation description)

(last modified April 15, 2010)


This file was created to facilitate the description of sequence variants in the PCNT gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_008961.1, covering PCNT transcript NM_006031.5.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                     .         .         .         .                g.5047
              gcggggggagggcgagcccaagcgcgggggagggagtgtaaatagag       c.-61

 .         .         .         .         .         .                g.5107
 cgaaggctgctctgtgtcagccccgtcaccgccgggcggcccgcgcggagtctgagggag       c.-1

          .         .         .         .         .     | 02   .    g.7261
 ATGGAAGTTGAGCAAGAGCAGCGGCGCAGAAAGGTGGAGGCCGGGAGGACGAAG | CTTGCT    c.60
 M  E  V  E  Q  E  Q  R  R  R  K  V  E  A  G  R  T  K   | L  A      p.20

          .         .         .         .         .         .       g.7321
 CACTTCCGACAGAGAAAAACAAAAGGTGACAGTTCGCATTCGGAGAAAAAGACGGCGAAG       c.120
 H  F  R  Q  R  K  T  K  G  D  S  S  H  S  E  K  K  T  A  K         p.40

          .         .         .         .         .         .       g.7381
 AGGAAGGGCTCGGCTGTCGATGCGTCTGTCCAGGAGGAGAGTCCGGTAACCAAGGAGGAC       c.180
 R  K  G  S  A  V  D  A  S  V  Q  E  E  S  P  V  T  K  E  D         p.60

          .         .         .         .         .         .       g.7441
 AGCGCACTCTGTGGAGGAGGGGACATTTGCAAAAGCACATCATGTGACGACACCCCTGAT       c.240
 S  A  L  C  G  G  G  D  I  C  K  S  T  S  C  D  D  T  P  D         p.80

          .         .        | 03.         .         .         .    g.15308
 GGGGCAGGAGGGGCCTTTGCAGCTCAG | CCGGAGGACTGTGATGGAGAGAAGAGAGAGGAC    c.300
 G  A  G  G  A  F  A  A  Q   | P  E  D  C  D  G  E  K  R  E  D      p.100

          .         .         .         .         .         .       g.15368
 TTGGAACAGCTGCAGCAGAAGCAAGTCAATGACCATCCTCCAGAGCAGTGTGGGATGTTC       c.360
 L  E  Q  L  Q  Q  K  Q  V  N  D  H  P  P  E  Q  C  G  M  F         p.120

          .         .         .         .         .         .       g.15428
 ACAGTCAGTGACCACCCACCAGAACAGCATGGGATGTTCACAGTCGGTGACCACCCACCA       c.420
 T  V  S  D  H  P  P  E  Q  H  G  M  F  T  V  G  D  H  P  P         p.140

          .         .         .         .         .         .       g.15488
 GAACAGCGTGGGATGTTCACAGTCAGTGACCACCCACCAGAACAGCATGGGATGTTCACA       c.480
 E  Q  R  G  M  F  T  V  S  D  H  P  P  E  Q  H  G  M  F  T         p.160

          .         .         .         .         .         .       g.15548
 GTCAGTGACCACCCACCAGAACAGCGTGGGATGTTCACAATCAGTGACCACCAACCGGAA       c.540
 V  S  D  H  P  P  E  Q  R  G  M  F  T  I  S  D  H  Q  P  E         p.180

          .         .         .         .         .         .       g.15608
 CAGCGTGGGATGTTCACAGTCAGTGACCACACACCAGAACAGCGTGGGATCTTCACAATC       c.600
 Q  R  G  M  F  T  V  S  D  H  T  P  E  Q  R  G  I  F  T  I         p.200

          .         .         .          | 04        .         .    g.27027
 AGTGACCACCCAGCAGAACAGCGTGGGATGTTCACAAAG | GAGTGTGAACAAGAATGTGAA    c.660
 S  D  H  P  A  E  Q  R  G  M  F  T  K   | E  C  E  Q  E  C  E      p.220

          .         .         .         .         .         .       g.27087
 CTTGCCATTACTGACCTGGAGAGCGGCCGTGAAGATGAGGCTGGCCTGCATCAGAGTCAG       c.720
 L  A  I  T  D  L  E  S  G  R  E  D  E  A  G  L  H  Q  S  Q         p.240

  | 05       .         .         .         .         .         .    g.27681
  | GCCGTGCATGGCCTTGAGCTGGAGGCGCTGCGCCTGAGTCTGAGCAACATGCACACGGCG    c.780
  | A  V  H  G  L  E  L  E  A  L  R  L  S  L  S  N  M  H  T  A      p.260

          .         .         .         .         .         .       g.27741
 CAGCTGGAGCTGACACAGGCCAACCTCCAGAAGGAGAAGGAGACGGCATTGACGGAGCTG       c.840
 Q  L  E  L  T  Q  A  N  L  Q  K  E  K  E  T  A  L  T  E  L         p.280

          .         .         .         .         .         .       g.27801
 CGGGAGATGCTCAACAGCCGGCGTGCCCAGGAGCTGGCCCTGCTACAGAGCAGGCAGCAG       c.900
 R  E  M  L  N  S  R  R  A  Q  E  L  A  L  L  Q  S  R  Q  Q         p.300

          .         .         .         .         .         .       g.27861
 CACGAGCTGGAGCTCCTCAGGGAGCAGCACGCACGGGAGAAGGAGGAGGTGGTGCTCAGG       c.960
 H  E  L  E  L  L  R  E  Q  H  A  R  E  K  E  E  V  V  L  R         p.320

          .       | 06 .         .         .         .         .    g.28379
 TGTGGACAGGAAGCAG | CTGAGCTGAAGGAGAAGTTACAATCAGAAATGGAGAAAAACGCC    c.1020
 C  G  Q  E  A  A |   E  L  K  E  K  L  Q  S  E  M  E  K  N  A      p.340

          .   | 07     .         .         .         .         .    g.29938
 CAGATAGTAAAG | ACCCTGAAGGAAGATTGGGAATCTGAAAAAGATTTATGTTTAGAAAAT    c.1080
 Q  I  V  K   | T  L  K  E  D  W  E  S  E  K  D  L  C  L  E  N      p.360

          .         .         .         .         .         .       g.29998
 CTACGCAAAGAACTGTCTGCAAAGCATCAATCAGAAATGGAGGATTTACAAAACCAGTTT       c.1140
 L  R  K  E  L  S  A  K  H  Q  S  E  M  E  D  L  Q  N  Q  F         p.380

          .         .         .         .         .         .       g.30058
 CAGAAAGAATTGGCAGAACAGAGAGCTGAGTTGGAGAAGATTTTTCAAGACAAAAACCAG       c.1200
 Q  K  E  L  A  E  Q  R  A  E  L  E  K  I  F  Q  D  K  N  Q         p.400

         | 08.         .         .         .         .         .    g.30615
 GCTGAAC | GGGCCCTTAGGAACCTGGAGAGTCATCATCAAGCAGCCATTGAGAAGTTACGT    c.1260
 A  E  R |   A  L  R  N  L  E  S  H  H  Q  A  A  I  E  K  L  R      p.420

          .         .         .         .         .         .       g.30675
 GAAGACCTGCAGTCCGAGCACGGCCGGTGTTTAGAAGACTTGGAGTTCAAGTTCAAAGAG       c.1320
 E  D  L  Q  S  E  H  G  R  C  L  E  D  L  E  F  K  F  K  E         p.440

          .         .     | 09   .         .         .         .    g.32343
 AGCGAGAAAGAAAAACAGCTGGAG | TTAGAGAATCTTCAAGCATCATATGAAGACCTGAAG    c.1380
 S  E  K  E  K  Q  L  E   | L  E  N  L  Q  A  S  Y  E  D  L  K      p.460

          .         .         .         .         .         .       g.32403
 GCACAATCACAAGAAGAGATCAGGCGCTTGTGGTCCCAGCTTGATTCTGCCAGGACCAGT       c.1440
 A  Q  S  Q  E  E  I  R  R  L  W  S  Q  L  D  S  A  R  T  S         p.480

          .       | 10 .         .         .         .         .    g.34026
 AGACAGGAATTGAGTG | AGCTACATGAGCAACTCCTGGCGCGCACCTCTCGTGTGGAAGAT    c.1500
 R  Q  E  L  S  E |   L  H  E  Q  L  L  A  R  T  S  R  V  E  D      p.500

          .         .         .         .         .         .       g.34086
 TTAGAACAGCTGAAGCAGCGAGAAAAAACCCAGCATGAGTCCGAACTGGAGCAACTGAGG       c.1560
 L  E  Q  L  K  Q  R  E  K  T  Q  H  E  S  E  L  E  Q  L  R         p.520

          .         .         .         .         .         .       g.34146
 ATTTATTTTGAAAAGAAGTTAAGGGATGCTGAGAAAACTTACCAAGAAGACCTAACCCTG       c.1620
 I  Y  F  E  K  K  L  R  D  A  E  K  T  Y  Q  E  D  L  T  L         p.540

          .         .         .         .         .          | 11    g.34866
 TTACAGCAGAGGCTGCAGGGGGCGAGGGAAGATGCTCTTCTGGACTCTGTGGAAGTTGG | G    c.1680
 L  Q  Q  R  L  Q  G  A  R  E  D  A  L  L  D  S  V  E  V  G  |      p.560

          .         .         .         .         .         .       g.34926
 TTGTCCTGTGTGGGTTTAGAAGAGAAACCTGAGAAAGGAAGAAAAGATCACGTTGATGAA       c.1740
 L  S  C  V  G  L  E  E  K  P  E  K  G  R  K  D  H  V  D  E         p.580

          .         .  | 12      .         .         .         .    g.36370
 CTCGAGCCTGAGCGACATAAG | GAGAGCCTGCCACGCTTCCAGGCGGAGTTAGAAGAAAGC    c.1800
 L  E  P  E  R  H  K   | E  S  L  P  R  F  Q  A  E  L  E  E  S      p.600

          .         .         .         .         .         .       g.36430
 CACAGGCACCAGCTGGAAGCGCTGGAGTCTCCCCTCTGCATCCAGCACGAGGGGCATGTC       c.1860
 H  R  H  Q  L  E  A  L  E  S  P  L  C  I  Q  H  E  G  H  V         p.620

          .         .         .         .         .         .       g.36490
 TCAGACAGATGCTGCGTAGAGACTTCAGCATTGGGACACGAGTGGCGTCTGGAACCCTCT       c.1920
 S  D  R  C  C  V  E  T  S  A  L  G  H  E  W  R  L  E  P  S         p.640

          .       | 13 .         .         .         .         .    g.37897
 GAAGGGCACAGCCAAG | AGCTTCCCTGGGTGCATCTCCAGGGTGTGCAGGACGGGGACTTG    c.1980
 E  G  H  S  Q  E |   L  P  W  V  H  L  Q  G  V  Q  D  G  D  L      p.660

          .         .         .         .         .         .       g.37957
 GAGGCCGACACAGAGCGGGCAGCCAGAGTCTTGGGTCTGGAAACTGAGCACAAGGTGCAA       c.2040
 E  A  D  T  E  R  A  A  R  V  L  G  L  E  T  E  H  K  V  Q         p.680

          .         .         .         .         .         .       g.38017
 CTTTCGCTTCTTCAGACTGAGCTCAAAGAAGAAATTGAACTCCTAAAAATAGAAAATAGA       c.2100
 L  S  L  L  Q  T  E  L  K  E  E  I  E  L  L  K  I  E  N  R         p.700

          .         .         .         .         .     | 14   .    g.44365
 AATTTGTATGGGAAGTTGCAGCATGAAACTCGTCTGAAGGACGATTTGGAGAAG | GTAAAA    c.2160
 N  L  Y  G  K  L  Q  H  E  T  R  L  K  D  D  L  E  K   | V  K      p.720

          .         .         .         .         .         .       g.44425
 CACAATCTAATTGAAGACCACCAGAAGGAACTAAATAATGCTAAGCAAAAGACTGAGCTG       c.2220
 H  N  L  I  E  D  H  Q  K  E  L  N  N  A  K  Q  K  T  E  L         p.740

          .         .         .         .         .         .       g.44485
 ATGAAACAGGAATTCCAAAGAAAAGAAACGGACTGGAAAGTTATGAAGGAGGAGCTACAG       c.2280
 M  K  Q  E  F  Q  R  K  E  T  D  W  K  V  M  K  E  E  L  Q         p.760

          .         .         .         .         .         .       g.44545
 CGGGAAGCTGAGGAGAAGTTAACATTGATGCTACTTGAACTGAGAGAAAAGGCTGAATCC       c.2340
 R  E  A  E  E  K  L  T  L  M  L  L  E  L  R  E  K  A  E  S         p.780

          .         .         .         .         .         .       g.44605
 GAGAAACAGACCATCATAAACAAGTTTGAGCTTCGAGAAGCTGAAATGAGGCAGCTTCAG       c.2400
 E  K  Q  T  I  I  N  K  F  E  L  R  E  A  E  M  R  Q  L  Q         p.800

          .         .         .         .         .         .       g.44665
 GACCAACAGGCAGCCCAGATCCTGGATCTGGAGAGGTCCTTGACGGAGCAGCAGGGCCGC       c.2460
 D  Q  Q  A  A  Q  I  L  D  L  E  R  S  L  T  E  Q  Q  G  R         p.820

          .         .         .         .         .         .       g.44725
 CTGCAGCAGCTGGAACAGGACCTCACTTCAGACGACGCCCTGCATTGCAGCCAGTGTGGG       c.2520
 L  Q  Q  L  E  Q  D  L  T  S  D  D  A  L  H  C  S  Q  C  G         p.840

          .         .         .         .         .         .       g.44785
 CGGGAGCCGCCCACAGCCCAGGACGGGGAGCTTGCTGCGCTCCACGTGAAGGAAGACTGC       c.2580
 R  E  P  P  T  A  Q  D  G  E  L  A  A  L  H  V  K  E  D  C         p.860

          .         .          | 15        .         .         .    g.47494
 GCCCTGCAGCTGATGCTGGCCCGGAGCAG | GTTTTTAGAGGAACGTAAAGAGATCACCGAG    c.2640
 A  L  Q  L  M  L  A  R  S  R  |  F  L  E  E  R  K  E  I  T  E      p.880

          .         .         .         .         .         .       g.47554
 AAATTCAGTGCGGAACAAGATGCCTTCCTGCAGGAGGCCCAGGAGCAGCATGCCCGTGAG       c.2700
 K  F  S  A  E  Q  D  A  F  L  Q  E  A  Q  E  Q  H  A  R  E         p.900

          .         .         .         .         .         .       g.47614
 CTGCAGCTCCTCCAGGAGAGACACCAGCAGCAGCTCCTGTCAGTGACGGCGGAGCTCGAG       c.2760
 L  Q  L  L  Q  E  R  H  Q  Q  Q  L  L  S  V  T  A  E  L  E         p.920

          .         .         .         .         .         .       g.47674
 GCCAGACACCAGGCCGCGTTGGGCGAGCTGACAGCCTCCTTAGAGAGCAAGCAGGGGGCT       c.2820
 A  R  H  Q  A  A  L  G  E  L  T  A  S  L  E  S  K  Q  G  A         p.940

          .         .         .         .         .         .       g.47734
 CTGCTGGCTGCACGTGTGGCCGAACTGCAGACAAAACACGCTGCCGACCTCGGCGCTCTG       c.2880
 L  L  A  A  R  V  A  E  L  Q  T  K  H  A  A  D  L  G  A  L         p.960

          .         .         .         .         .         .       g.47794
 GAGACCAGACATCTGTCCAGCCTTGATTCTTTGGAATCCTGTTACCTCTCTGAATTTCAG       c.2940
 E  T  R  H  L  S  S  L  D  S  L  E  S  C  Y  L  S  E  F  Q         p.980

          .         .         .         .         .         .       g.47854
 ACCATCCGTGAGGAGCACAGGCAGGCCCTAGAGCTCTTACGAGCAGACTTTGAGGAACAA       c.3000
 T  I  R  E  E  H  R  Q  A  L  E  L  L  R  A  D  F  E  E  Q         p.1000

          .         .         .         .         .         .       g.47914
 CTGTGGAAAAAGGACTCTCTTCACCAAACGATTTTGACTCAAGAGTTGGAGAAACTGAAG       c.3060
 L  W  K  K  D  S  L  H  Q  T  I  L  T  Q  E  L  E  K  L  K         p.1020

          .         .         .         .         .         .       g.47974
 CGGAAACACGAAGGGGAGCTACAGTCTGTGCGGGACCACCTGCGAACCGAAGTGAGCACA       c.3120
 R  K  H  E  G  E  L  Q  S  V  R  D  H  L  R  T  E  V  S  T         p.1040

          .         .         .         .      | 16  .         .    g.62588
 GAGCTCGCCGGAACCGTGGCTCACGAGCTGCAGGGAGTGCACCAG | GGTGAATTTGGAAGT    c.3180
 E  L  A  G  T  V  A  H  E  L  Q  G  V  H  Q   | G  E  F  G  S      p.1060

          .         .         .         .         .         .       g.62648
 GAAAAGAAAACTGCTTTGCATGAAAAAGAGGAGACACTTCGGCTTCAGAGTGCACAGGCA       c.3240
 E  K  K  T  A  L  H  E  K  E  E  T  L  R  L  Q  S  A  Q  A         p.1080

          .         .         .         .         .         .       g.62708
 CAGCCTTTTCACCAAGAGGAGAAAGAGTCTTTGTCTCTGCAGCTTCAAAAGAAGAATCAC       c.3300
 Q  P  F  H  Q  E  E  K  E  S  L  S  L  Q  L  Q  K  K  N  H         p.1100

          .   | 17     .         .         .         .         .    g.66759
 CAAGTCCAGCAG | CTGAAAGACCAGGTTTTATCCTTAAGTCACGAGATAGAAGAGTGCCGC    c.3360
 Q  V  Q  Q   | L  K  D  Q  V  L  S  L  S  H  E  I  E  E  C  R      p.1120

          .         .         .         .         .         .       g.66819
 TCCGAGTTGGAGGTGCTGCAGCAGAGGCGGGAGCGGGAGAACCGGGAAGGCGCAAACCTC       c.3420
 S  E  L  E  V  L  Q  Q  R  R  E  R  E  N  R  E  G  A  N  L         p.1140

          .         .         .         .     | 18   .         .    g.69637
 CTCTCCATGCTCAAGGCCGACGTCAACCTGTCCCACAGCGAAAG | AGGGGCCCTCCAGGAC    c.3480
 L  S  M  L  K  A  D  V  N  L  S  H  S  E  R  |  G  A  L  Q  D      p.1160

          .         .         .         .         .         .       g.69697
 GCCCTGCGCAGGCTGCTGGGTTTGTTTGGAGAGACGCTGAGGGCAGCCGTCACCCTGAGG       c.3540
 A  L  R  R  L  L  G  L  F  G  E  T  L  R  A  A  V  T  L  R         p.1180

          .         .         .         .         .         .       g.69757
 AGCCGGATCGGGGAGCGCGTGGGGCTCTGCCTGGATGACGCGGGCGCAGGCCTGGCCCTG       c.3600
 S  R  I  G  E  R  V  G  L  C  L  D  D  A  G  A  G  L  A  L         p.1200

         | 19.         .         .         .         .         .    g.70131
 TCGACAG | CTCCGGCGCTGGAGGAGACATGGTCTGATGTGGCCCTCCCGGAGTTGGACAGA    c.3660
 S  T  A |   P  A  L  E  E  T  W  S  D  V  A  L  P  E  L  D  R      p.1220

          .         .         .         .         .         .       g.70191
 ACTTTGTCTGAATGTGCAGAGATGTCTTCCGTGGCTGAAATTAGCAGCCACATGCGTGAA       c.3720
 T  L  S  E  C  A  E  M  S  S  V  A  E  I  S  S  H  M  R  E         p.1240

          .         .         .         .         .         .       g.70251
 AGCTTTCTCATGAGCCCAGAAAGTGTGCGGGAGTGTGAGCAGCCCATCCGGAGGGTCTTC       c.3780
 S  F  L  M  S  P  E  S  V  R  E  C  E  Q  P  I  R  R  V  F         p.1260

          .         .         .         .         .         .       g.70311
 CAGAGCCTCAGCCTGGCCGTGGACGGCCTCATGGAGATGGCCCTGGACTCCAGCAGGCAG       c.3840
 Q  S  L  S  L  A  V  D  G  L  M  E  M  A  L  D  S  S  R  Q         p.1280

  | 20       .         .         .         .         .         .    g.71609
  | CTGGAAGAAGCACGCCAAATTCATTCTCGTTTTGAAAAAGAATTTAGTTTTAAGAATGAG    c.3900
  | L  E  E  A  R  Q  I  H  S  R  F  E  K  E  F  S  F  K  N  E      p.1300

          .         .         .         .         .         .       g.71669
 GAGACAGCACAGGTTGTCAGGAAGCACCAGGAGCTGCTGGAGTGTTTGAAGGAGGAGAGC       c.3960
 E  T  A  Q  V  V  R  K  H  Q  E  L  L  E  C  L  K  E  E  S         p.1320

          .         .         .         .    | 21    .         .    g.72060
 GCAGCAAAGGCAGAGCTGGCGCTGGAGCTGCACAAGACTCAGG | GTACCCTTGAGGGATTC    c.4020
 A  A  K  A  E  L  A  L  E  L  H  K  T  Q  G |   T  L  E  G  F      p.1340

          .         .         .         .         .         .       g.72120
 AAGGTGGAGACAGCAGATCTGAAGGAGGTGCTGGCCGGGAAGGAGGATTCCGAGCACCGT       c.4080
 K  V  E  T  A  D  L  K  E  V  L  A  G  K  E  D  S  E  H  R         p.1360

          .         .         .         .         .         .       g.72180
 CTGGTGCTGGAGCTGGAGAGCCTGAGACGGCAGCTGCAGCAGGCGGCCCAGGAGCAGGCG       c.4140
 L  V  L  E  L  E  S  L  R  R  Q  L  Q  Q  A  A  Q  E  Q  A         p.1380

          .         .         .         .         .         .       g.72240
 GCGCTGAGGGAGGAGTGCACCCGTCTGTGGAGTCGGGGGGAGGCCACAGCCACGGACGCC       c.4200
 A  L  R  E  E  C  T  R  L  W  S  R  G  E  A  T  A  T  D  A         p.1400

          .       | 22 .         .         .         .         .    g.78187
 GAGGCCAGAGAAGCTG | CTCTCCGGAAGGAAGTGGAGGATCTGACCAAAGAACAGTCGGAG    c.4260
 E  A  R  E  A  A |   L  R  K  E  V  E  D  L  T  K  E  Q  S  E      p.1420

          .         .         .         .         .         .       g.78247
 ACCAGGAAGCAGGCTGAGAAGGACCGCTCAGCCCTGCTCTCCCAGATGAAGATTTTGGAG       c.4320
 T  R  K  Q  A  E  K  D  R  S  A  L  L  S  Q  M  K  I  L  E         p.1440

          .         .         .         .         .         .       g.78307
 TCTGAGTTAGAAGAACAGCTGTCTCAGCATCGCGGGTGTGCCAAGCAGGCGGAGGCCGTC       c.4380
 S  E  L  E  E  Q  L  S  Q  H  R  G  C  A  K  Q  A  E  A  V         p.1460

          .         .         .         .         .         .       g.78367
 ACTGCCCTGGAACAGCAGGTGGCATCTCTGGACAAGCATTTGCGCAACCAGCGGCAATTC       c.4440
 T  A  L  E  Q  Q  V  A  S  L  D  K  H  L  R  N  Q  R  Q  F         p.1480

        | 23 .         .         .         .         .         .    g.78946
 ATGGAT | GAGCAGGCAGCCGAGCGGGAGCACGAGCGCGAGGAGTTCCAGCAGGAGATTCAG    c.4500
 M  D   | E  Q  A  A  E  R  E  H  E  R  E  E  F  Q  Q  E  I  Q      p.1500

          .         .         .         .         .         .       g.79006
 AGGCTGGAGGGGCAGCTCCGCCAGGCGGCCAAGCCGCAGCCCTGGGGCCCTCGCGACAGC       c.4560
 R  L  E  G  Q  L  R  Q  A  A  K  P  Q  P  W  G  P  R  D  S         p.1520

     | 24    .         .     | 25   .         .         .         . g.80504
 CAG | CAGGCGCCGCTGGATGGAGAG | GTTGAGTTGTTACAACAAAAGTTGAGAGAAAAGTTG c.4620
 Q   | Q  A  P  L  D  G  E   | V  E  L  L  Q  Q  K  L  R  E  K  L   p.1540

          .         .         .         .         .         .       g.80564
 GATGAATTTAATGAATTGGCTATACAGAAAGAGTCGGCAGATAGACAAGTGTTAATGCAG       c.4680
 D  E  F  N  E  L  A  I  Q  K  E  S  A  D  R  Q  V  L  M  Q         p.1560

          .         .         .         .         .         .       g.80624
 GAAGAAGAAATTAAACGTCTGGAGGAGATGAACATCAACATCAGGAAAAAAGTGGCCCAG       c.4740
 E  E  E  I  K  R  L  E  E  M  N  I  N  I  R  K  K  V  A  Q         p.1580

          .         .         .         .         .  | 26      .    g.82438
 CTCCAGGAAGAAGTGGAAAAACAGAAAAACATCGTGAAAGGGCTGGAACAG | GATAAAGAG    c.4800
 L  Q  E  E  V  E  K  Q  K  N  I  V  K  G  L  E  Q   | D  K  E      p.1600

          .         .         .         .         .         .       g.82498
 GTGTTAAAGAAACAGCAGATGAGTAGCTTGCTTCTGGCGTCCACGTTGCAGTCTACACTA       c.4860
 V  L  K  K  Q  Q  M  S  S  L  L  L  A  S  T  L  Q  S  T  L         p.1620

          .         .         .         .         .         .       g.82558
 GATGCAGGCAGATGTCCCGAGCCTCCTTCGGGCAGCCCTCCTGAGGGTCCAGAAATACAG       c.4920
 D  A  G  R  C  P  E  P  P  S  G  S  P  P  E  G  P  E  I  Q         p.1640

          .         .         .         .   | 27     .         .    g.83227
 TTAGAGGTGACACAGAGAGCACTCCTGCGGCGCGAGAGCGAG | GTTTTGGACTTAAAAGAA    c.4980
 L  E  V  T  Q  R  A  L  L  R  R  E  S  E   | V  L  D  L  K  E      p.1660

          .         .         .         .         .         .       g.83287
 CAGCTAGAAAAGATGAAAGGTGACTTAGAAAGTAAAAATGAAGAAATACTACATCTGAAC       c.5040
 Q  L  E  K  M  K  G  D  L  E  S  K  N  E  E  I  L  H  L  N         p.1680

          .         .         .         .         .         .       g.83347
 TTAAAATTGGACATGCAGAACAGCCAGACTGCTGTCAGCCTCAGAGAACTTGAGGAAGAG       c.5100
 L  K  L  D  M  Q  N  S  Q  T  A  V  S  L  R  E  L  E  E  E         p.1700

          .      | 28  .         .         .         .         .    g.92112
 AACACGAGCTTGAAG | GTCATATATACCAGAAGTTCTGAGATTGAAGAGCTGAAAGCCACT    c.5160
 N  T  S  L  K   | V  I  Y  T  R  S  S  E  I  E  E  L  K  A  T      p.1720

          .         .         .         .         .         .       g.92172
 ATTGAAAATCTGCAAGAGAATCAGAAACGATTACAAAAGGAGAAAGCAGAGGAAATTGAA       c.5220
 I  E  N  L  Q  E  N  Q  K  R  L  Q  K  E  K  A  E  E  I  E         p.1740

          .         .         .         .         .         .       g.92232
 CAACTCCATGAAGTCATTGAGAAGCTGCAGCACGAGCTGTCCCTCATGGGGCCTGTGGTG       c.5280
 Q  L  H  E  V  I  E  K  L  Q  H  E  L  S  L  M  G  P  V  V         p.1760

          .         .         .         .         .         .       g.92292
 CACGAAGTCAGCGACAGTCAGGCTGGCAGTCTGCAGAGCGAGCTGCTCTGCTCCCAGGCC       c.5340
 H  E  V  S  D  S  Q  A  G  S  L  Q  S  E  L  L  C  S  Q  A         p.1780

          .         .         .         .         .         .       g.92352
 GGGGGCCCTCGTGGGCAGGCCCTACAGGGCGAGCTCGAGGCTGCGCTGGAAGCCAAGGAG       c.5400
 G  G  P  R  G  Q  A  L  Q  G  E  L  E  A  A  L  E  A  K  E         p.1800

          .         .         .         .         .         .       g.92412
 GCCCTGAGCCGGCTGCTGGCTGACCAGGAGCGCAGGCACAGCCAGGCCCTGGAGGCCCTG       c.5460
 A  L  S  R  L  L  A  D  Q  E  R  R  H  S  Q  A  L  E  A  L         p.1820

          .         .         .         .         .         .       g.92472
 CAGCAGCGCCTCCAGGGCGCAGAGGAGGCTGCGGAGCTACAGCTGGCTGAGCTGGAGCGC       c.5520
 Q  Q  R  L  Q  G  A  E  E  A  A  E  L  Q  L  A  E  L  E  R         p.1840

          .         .         .         .         .         .       g.92532
 AATGTAGCCCTCAGGGAGGCTGAGGTCGAAGACATGGCCTCCCGGATCCAGGAGTTCGAA       c.5580
 N  V  A  L  R  E  A  E  V  E  D  M  A  S  R  I  Q  E  F  E         p.1860

          .         .         .         .         .         .       g.92592
 GCGGCCCTGAAAGCAAAGGAAGCGACGATTGCCGAGAGAAATTTAGAAATCGACGCTCTG       c.5640
 A  A  L  K  A  K  E  A  T  I  A  E  R  N  L  E  I  D  A  L         p.1880

          .         .         .         .         .         .       g.92652
 AACCAGCGGAAGGCGGCCCACTCTGCCGAGCTGGAGGCCGTCCTGTTGGCCTTGGCCCGC       c.5700
 N  Q  R  K  A  A  H  S  A  E  L  E  A  V  L  L  A  L  A  R         p.1900

          .         .         .         .         .         .       g.92712
 ATCCGCCGCGCCCTGGAGCAGCAGCCCCTGGCAGCCGGGGCGGCGCCTCCCGAGCTGCAG       c.5760
 I  R  R  A  L  E  Q  Q  P  L  A  A  G  A  A  P  P  E  L  Q         p.1920

          .         .         .         .         .         .       g.92772
 TGGCTCCGAGCGCAGTGTGCCCGCCTCAGCCGCCAGCTGCAGGTGCTGCACCAGCGGTTC       c.5820
 W  L  R  A  Q  C  A  R  L  S  R  Q  L  Q  V  L  H  Q  R  F         p.1940

          .         .         .         .         .         .       g.92832
 CTGAGGTGCCAGGTGGAGCTGGACAGGCGGCAGGCCCGCAGAGCCACAGCTCACACACGG       c.5880
 L  R  C  Q  V  E  L  D  R  R  Q  A  R  R  A  T  A  H  T  R         p.1960

          .         .         .         .         .         .       g.92892
 GTGCCCGGGGCCCACCCACAGCCTCGCATGGATGGTGGCGCCAAGGCCCAGGTCACCGGC       c.5940
 V  P  G  A  H  P  Q  P  R  M  D  G  G  A  K  A  Q  V  T  G         p.1980

          .         .         .         .         .     | 29   .    g.93721
 GACGTGGAGGCCTCCCATGATGCTGCTTTGGAGCCGGTTGTCCCTGACCCACAG | GGTGAT    c.6000
 D  V  E  A  S  H  D  A  A  L  E  P  V  V  P  D  P  Q   | G  D      p.2000

          .         .         .         .         .         .       g.93781
 CTGCAGCCTGTCCTGGTGACGTTGAAGGATGCACCTCTCTGCAAGCAAGAAGGCGTGATG       c.6060
 L  Q  P  V  L  V  T  L  K  D  A  P  L  C  K  Q  E  G  V  M         p.2020

          .         .         .         .         .         .       g.93841
 TCAGTGCTCACCGTCTGCCAGAGGCAGCTGCAGTCGGAGCTGCTCTTGGTGAAAAATGAA       c.6120
 S  V  L  T  V  C  Q  R  Q  L  Q  S  E  L  L  L  V  K  N  E         p.2040

          .         .         . | 30       .         .         .    g.96977
 ATGCGCCTGAGTCTGGAGGACGGCGGCAAG | GGTAAAGAAAAAGTACTGGAAGATTGTCAG    c.6180
 M  R  L  S  L  E  D  G  G  K   | G  K  E  K  V  L  E  D  C  Q      p.2060

          .         .         .         .         .         .       g.97037
 CTGCCGAAGGTCGATCTCGTAGCTCAGGTGAAACAGCTTCAGGAAAAACTGAACCGTTTG       c.6240
 L  P  K  V  D  L  V  A  Q  V  K  Q  L  Q  E  K  L  N  R  L         p.2080

          .         .         .         .         .         .       g.97097
 CTGTATTCCATGACCTTCCAGAATGTGGATGCTGCCGACACCAAATCTCTGTGGCCCATG       c.6300
 L  Y  S  M  T  F  Q  N  V  D  A  A  D  T  K  S  L  W  P  M         p.2100

          .         .         .         .         .         .       g.97157
 GCCTCAGCACACCTGTTGGAGAGCAGCTGGAGTGATGATTCCTGTGACGGAGAAGAGCCT       c.6360
 A  S  A  H  L  L  E  S  S  W  S  D  D  S  C  D  G  E  E  P         p.2120

          .         .         .         .         .         .       g.97217
 GACATATCACCCCACATAGACACATGTGATGCCAATACAGCCACGGGGGGTGTAACTGAT       c.6420
 D  I  S  P  H  I  D  T  C  D  A  N  T  A  T  G  G  V  T  D         p.2140

          .         .         .         .         .         .       g.97277
 GTTATCAAAAATCAGGCCATAGACGCGTGTGATGCCAATACAACCCCAGGGGGTGTAACT       c.6480
 V  I  K  N  Q  A  I  D  A  C  D  A  N  T  T  P  G  G  V  T         p.2160

          .         .         .         .         .         .       g.97337
 GATGTTATCAAAAATTGGGATTCCTTGATACCAGATGAAATGCCAGATTCTCCCATTCAA       c.6540
 D  V  I  K  N  W  D  S  L  I  P  D  E  M  P  D  S  P  I  Q         p.2180

          .         .         .         .         .         .       g.97397
 GAAAAATCAGAATGTCAGGACATGTCTCTTTCTTCACCGACCAGCGTACTTGGTGGCTCC       c.6600
 E  K  S  E  C  Q  D  M  S  L  S  S  P  T  S  V  L  G  G  S         p.2200

          .         .         .         .         .         .       g.97457
 CGCCACCAGAGCCACACTGCAGAGGCTGGGCCCCGGAAGAGCCCGGTCGGGATGCTGGAC       c.6660
 R  H  Q  S  H  T  A  E  A  G  P  R  K  S  P  V  G  M  L  D         p.2220

          .         .         .         .         .         .       g.97517
 CTGTCTTCCTGGAGCTCCCCTGAGGTCCTCAGGAAGGACTGGACCCTGGAGCCCTGGCCC       c.6720
 L  S  S  W  S  S  P  E  V  L  R  K  D  W  T  L  E  P  W  P         p.2240

          .         .         .         .         .         .       g.97577
 AGCCTCCCCGTGACACCCCACTCAGGAGCCCTGAGCCTGTGCAGTGCCGACACATCCCTG       c.6780
 S  L  P  V  T  P  H  S  G  A  L  S  L  C  S  A  D  T  S  L         p.2260

          .         .         .         .         .         .       g.97637
 GGGGACAGGGCGGACACCTCGCTGCCACAGACCCAGGGGCCGGGGCTGCTTTGTTCCCCA       c.6840
 G  D  R  A  D  T  S  L  P  Q  T  Q  G  P  G  L  L  C  S  P         p.2280

          .         .         .         .         .         .       g.97697
 GGCGTGTCTGCAGCAGCGCTGGCACTGCAGTGGGCCGAGTCTCCGCCGGCTGACGACCAC       c.6900
 G  V  S  A  A  A  L  A  L  Q  W  A  E  S  P  P  A  D  D  H         p.2300

          .         .  | 31      .         .         .         .    g.99121
 CATGTGCAGAGGACGGCTGTG | GAGAAAGATGTCGAAGATTTTATCACAACATCCTTTGAT    c.6960
 H  V  Q  R  T  A  V   | E  K  D  V  E  D  F  I  T  T  S  F  D      p.2320

          .         .         .         .         .         .       g.99181
 TCTCAAGAAACATTAAGTTCACCTCCTCCTGGATTAGAAGGAAAAGCTGATAGAAGTGAG       c.7020
 S  Q  E  T  L  S  S  P  P  P  G  L  E  G  K  A  D  R  S  E         p.2340

      | 32   .         .         .         .         .         .    g.102904
 AAAA | GTGACGGCTCGGGTTTTGGAGCAAGACTGAGCCCGGGGTCAGGAGGCCCTGAGGCT    c.7080
 K  S |   D  G  S  G  F  G  A  R  L  S  P  G  S  G  G  P  E  A      p.2360

          .         .         .         .         .         .       g.102964
 CAAACTGCTGGTCCTGTGACCCCTGCTTCCATCTCTGGAAGGTTTCAGCCGCTGCCGGAA       c.7140
 Q  T  A  G  P  V  T  P  A  S  I  S  G  R  F  Q  P  L  P  E         p.2380

          .         .         .          | 33        .         .    g.106730
 GCCATGAAGGAGAAGGAAGTGCGTCCGAAGCACGTGAAG | GCTTTACTGCAGATGGTGCGT    c.7200
 A  M  K  E  K  E  V  R  P  K  H  V  K   | A  L  L  Q  M  V  R      p.2400

          .         .         .         .         .         .       g.106790
 GACGAGAGCCACCAGATCCTGGCGCTGTCAGAAGGCCTTGCACCCCCAAGCGGCGAGCCA       c.7260
 D  E  S  H  Q  I  L  A  L  S  E  G  L  A  P  P  S  G  E  P         p.2420

          .         .         .         .         .         .       g.106850
 CACCCACCCCGGAAGGAAGACGAGATACAGGACATCTCGCTCCATGGGGGAAAGACGCAG       c.7320
 H  P  P  R  K  E  D  E  I  Q  D  I  S  L  H  G  G  K  T  Q         p.2440

  | 34       .         .         .         .         .         .    g.108560
  | GAAGTGCCCACCGCGTGCCCCGATTGGAGAGGGGACCTTCTGCAGGTTGTGCAAGAGGCC    c.7380
  | E  V  P  T  A  C  P  D  W  R  G  D  L  L  Q  V  V  Q  E  A      p.2460

          .         .         .         .         .         .       g.108620
 TTTGAAAAAGAGCAGGAGATGCAGGGGGTTGAGCTGCAGCCCCGACTCAGTGGCTCAGAT       c.7440
 F  E  K  E  Q  E  M  Q  G  V  E  L  Q  P  R  L  S  G  S  D         p.2480

          .         .         .         .         .     | 35   .    g.109279
 CTGGGGGGTCACAGCTCCCTGCTCGAAAGGCTGGAGAAGATCATCCGTGAGCAG | GGAGAC    c.7500
 L  G  G  H  S  S  L  L  E  R  L  E  K  I  I  R  E  Q   | G  D      p.2500

          .         .         .         .         .         .       g.109339
 CTGCAGGAAAAGTCCCTGGAGCATCTTCGCTTGCCGGACCGGAGCAGCCTGCTGTCCGAG       c.7560
 L  Q  E  K  S  L  E  H  L  R  L  P  D  R  S  S  L  L  S  E         p.2520

          .         .         .         .         .         .       g.109399
 ATCCAGGCGCTGCGTGCCCAGCTGCGCATGACGCACCTGCAGAACCAGGAGAAGCTGCAG       c.7620
 I  Q  A  L  R  A  Q  L  R  M  T  H  L  Q  N  Q  E  K  L  Q         p.2540

          .         .         .         .         .         .       g.109459
 CACTTGCGCACGGCGCTGACAAGCGCAGAGGCGCGCGGGAGCCAGCAGGAGCACCAGCTG       c.7680
 H  L  R  T  A  L  T  S  A  E  A  R  G  S  Q  Q  E  H  Q  L         p.2560

          . | 36       .         .         .         .         .    g.110938
 CGCAGGCAGG | TTGAACTGCTGGCTTATAAAGTAGAGCAGGAGAAGTGCATTGCTGGTGAC    c.7740
 R  R  Q  V |   E  L  L  A  Y  K  V  E  Q  E  K  C  I  A  G  D      p.2580

          .         .         .         .         .         .       g.110998
 TTGCAGAAGACGCTGAGTGAAGAGCAAGAGAAGGCAAACAGCGTGCAGAAGCTCCTGGCG       c.7800
 L  Q  K  T  L  S  E  E  Q  E  K  A  N  S  V  Q  K  L  L  A         p.2600

          .         .         .         .         .         .       g.111058
 GCGGAGCAGACTGTAGTGCGAGATTTGAAGTCCGACCTCTGTGAGAGCAGGCAGAAGAGC       c.7860
 A  E  Q  T  V  V  R  D  L  K  S  D  L  C  E  S  R  Q  K  S         p.2620

          .         .         .         .         .    | 37    .    g.111392
 GAACAGCTGTCCCGGTCCCTCTGCGAGGTGCAGCAGGAGGTCCTCCAGCTGAG | ATCCATG    c.7920
 E  Q  L  S  R  S  L  C  E  V  Q  Q  E  V  L  Q  L  R  |  S  M      p.2640

          .         .         .         .         .         .       g.111452
 CTGAGCAGTAAGGAGAACGAGCTGAAGGCCGCGCTTCAGGAGCTGGAGAGTGAGCAGGGG       c.7980
 L  S  S  K  E  N  E  L  K  A  A  L  Q  E  L  E  S  E  Q  G         p.2660

          .         .         .         .         .         .       g.111512
 AAGGGGCGTGCCCTGCAGAGCCAGCTGGAGGAGGAGCAGCTGCGGCACCTGCAGAGGGAG       c.8040
 K  G  R  A  L  Q  S  Q  L  E  E  E  Q  L  R  H  L  Q  R  E         p.2680

          .         .     | 38   .         .         .         .    g.112443
 AGCCAGAGTGCCAAGGCCCTGGAG | GAGCTGCGGGCGTCTTTGGAGACACAGCGTGCTCAG    c.8100
 S  Q  S  A  K  A  L  E   | E  L  R  A  S  L  E  T  Q  R  A  Q      p.2700

          .         .         .         .         .         .       g.112503
 AGCAGTCGACTCTGCGTGGCACTGAAACACGAGCAGACGGCCAAGGACAACCTGCAGAAG       c.8160
 S  S  R  L  C  V  A  L  K  H  E  Q  T  A  K  D  N  L  Q  K         p.2720

          .         .         .         .         .         .       g.112563
 GAGCTGCGTATCGAGCACTCACGCTGCGAGGCCTTGCTGGCTCAGGAGCGGAGCCAGCTC       c.8220
 E  L  R  I  E  H  S  R  C  E  A  L  L  A  Q  E  R  S  Q  L         p.2740

          .         .         .         .         .         .       g.112623
 TCTGAGCTCCAGAAGGACCTTGCGGCTGAGAAGAGCCGCACCCTGGAGCTGTCAGAGGCC       c.8280
 S  E  L  Q  K  D  L  A  A  E  K  S  R  T  L  E  L  S  E  A         p.2760

          .         .         .         .         .         .       g.112683
 TTGCGGCACGAGCGGCTCCTGACCGAGCAGCTGAGCCAGAGGACACAGGAGGCTTGCGTG       c.8340
 L  R  H  E  R  L  L  T  E  Q  L  S  Q  R  T  Q  E  A  C  V         p.2780

          .         .         .         .         .         .       g.112743
 CACCAGGACACACAGGCCCATCACGCTCTGCTGCAGAAGCTGAAGGAGGAGAAGTCCCGG       c.8400
 H  Q  D  T  Q  A  H  H  A  L  L  Q  K  L  K  E  E  K  S  R         p.2800

          .         .         .         .         .         .       g.112803
 GTGGTGGACTTGCAAGCGATGCTTGAAAAGGTGCAGCAGCAAGCCCTGCATTCTCAGCAG       c.8460
 V  V  D  L  Q  A  M  L  E  K  V  Q  Q  Q  A  L  H  S  Q  Q         p.2820

          .         .         .         .         .         .       g.112863
 CAGCTTGAGGCTGAGGCTCAGAAGCACTGTGAGGCGCTCAGGAGAGAGAAGGAGGTAAGT       c.8520
 Q  L  E  A  E  A  Q  K  H  C  E  A  L  R  R  E  K  E  V  S         p.2840

          .         .         .         .         .         .       g.112923
 GCCACACTGAAGTCGACGGTGGAAGCCCTGCACACCCAAAAACGAGAGCTGAGATGCTCT       c.8580
 A  T  L  K  S  T  V  E  A  L  H  T  Q  K  R  E  L  R  C  S         p.2860

          .         .         .         .         .         .       g.112983
 CTGGAGAGAGAGAGGGAGAAACCAGCGTGGTTGCAGGCAGAATTAGAGCAGTCACACCCA       c.8640
 L  E  R  E  R  E  K  P  A  W  L  Q  A  E  L  E  Q  S  H  P         p.2880

          .         .         .         .         .         .       g.113043
 CGGTTGAAAGAGCAAGAAGGACGCAAGGCTGCGAGGAGGAGCGCGGAGGCCAGGCAGAGC       c.8700
 R  L  K  E  Q  E  G  R  K  A  A  R  R  S  A  E  A  R  Q  S         p.2900

          .         .         .         .         .  | 39      .    g.116790
 CCAGCGGCTGCGGAGCAGTGGAGGAAGTGGCAGAGAGACAAGGAGAAGCTG | CGAGAATTA    c.8760
 P  A  A  A  E  Q  W  R  K  W  Q  R  D  K  E  K  L   | R  E  L      p.2920

          .         .         .         .         .         .       g.116850
 GAACTGCAGCGTCAGCGTGACTTGCATAAGATCAAGCAGCTTCAGCAGACAGTGAGAGAC       c.8820
 E  L  Q  R  Q  R  D  L  H  K  I  K  Q  L  Q  Q  T  V  R  D         p.2940

          .         .         .         .         .         .       g.116910
 CTGGAGTCGAAGGACGAGGTGCCTGGCAGCCGCCTCCACCTAGGTTCTGCCCGCAGGGCT       c.8880
 L  E  S  K  D  E  V  P  G  S  R  L  H  L  G  S  A  R  R  A         p.2960

          .         .         .         .         .         .       g.116970
 GCCGGCTCGGATGCGGACCACCTCCGGGAACAGCAGCGAGAGCTGGAGGCGATGAGGCAG       c.8940
 A  G  S  D  A  D  H  L  R  E  Q  Q  R  E  L  E  A  M  R  Q         p.2980

          .         .         .         .         .       | 40 .    g.117860
 CGGCTGCTCTCTGCCGCCCGGCTTCTCACCAGCTTCACCAGCCAGGCCGTGGACAG | GACA    c.9000
 R  L  L  S  A  A  R  L  L  T  S  F  T  S  Q  A  V  D  R  |  T      p.3000

          .         .         .         .         .         .       g.117920
 GTTAATGATTGGACGTCATCCAATGAGAAAGCAGTGATGTCTTTACTGCACACGTTGGAG       c.9060
 V  N  D  W  T  S  S  N  E  K  A  V  M  S  L  L  H  T  L  E         p.3020

          .         .         .          | 41        .         .    g.119062
 GAGCTGAAGTCTGACTTGAGCAGGCCCACCTCCTCCCAG | AAAAAAATGGCAGCAGAGCTG    c.9120
 E  L  K  S  D  L  S  R  P  T  S  S  Q   | K  K  M  A  A  E  L      p.3040

          .         .         .         .         .         .       g.119122
 CAGTTCCAGTTTGTGGACGTCCTGCTGAAAGACAATGTTTCCCTCACAAAAGCGCTCAGC       c.9180
 Q  F  Q  F  V  D  V  L  L  K  D  N  V  S  L  T  K  A  L  S         p.3060

          .         .         .         .         .         .       g.119182
 ACGGTGACCCAGGAGAAGCTGGAGCTGAGCAGAGCCGTGTCTAAGCTTGAGAAGTTGCTG       c.9240
 T  V  T  Q  E  K  L  E  L  S  R  A  V  S  K  L  E  K  L  L         p.3080

          .         .         .    | 42    .         .         .    g.120987
 AAGCACCATCTGCAGAAGGGCTGCAGCCCAAGC | AGGTCGGAAAGGTCTGCTTGGAAGCCA    c.9300
 K  H  H  L  Q  K  G  C  S  P  S   | R  S  E  R  S  A  W  K  P      p.3100

          .         .         .         .         .         .       g.121047
 GACGAAACGGCTCCACAGAGTTCCCTGAGGCGCCCAGACCCCGGCCGGCTTCCACCAGCT       c.9360
 D  E  T  A  P  Q  S  S  L  R  R  P  D  P  G  R  L  P  P  A         p.3120

          .         .         .    | 43    .         .         .    g.121759
 GCCAGCGAGGAAGCACACACCAGCAATGTCAAG | ATGGAAAAATTGTACCTGCATTACTTG    c.9420
 A  S  E  E  A  H  T  S  N  V  K   | M  E  K  L  Y  L  H  Y  L      p.3140

          .         .         .         .         .         .       g.121819
 AGAGCAGAGAGCTTTAGAAAAGCTCTGATTTATCAAAAGAAGTATCTTTTGCTGTTGATT       c.9480
 R  A  E  S  F  R  K  A  L  I  Y  Q  K  K  Y  L  L  L  L  I         p.3160

          .         .         .         .         .         .       g.121879
 GGTGGATTCCAGGATTCTGAACAAGAAACACTCTCCATGATTGCCCATTTGGGGGTATTT       c.9540
 G  G  F  Q  D  S  E  Q  E  T  L  S  M  I  A  H  L  G  V  F         p.3180

          .         .         .         .         .         .       g.121939
 CCTTCCAAAGCAGAACGGAAAATCACATCTCGTCCTTTCACCAGGTTCCGCACGGCCGTC       c.9600
 P  S  K  A  E  R  K  I  T  S  R  P  F  T  R  F  R  T  A  V         p.3200

          .         .    | 44    .         .         .         .    g.123411
 AGGGTGGTCATTGCAATATTAAG | ATTACGTTTTTTGGTTAAGAAATGGCAAGAAGTAGAT    c.9660
 R  V  V  I  A  I  L  R  |  L  R  F  L  V  K  K  W  Q  E  V  D      p.3220

          .         .         .         . | 45       .         .    g.124707
 CGGAAAGGAGCTCTGGCACAAGGCAAAGCCCCTCGCCCAG | GGCCCCGAGCACGACAGCCG    c.9720
 R  K  G  A  L  A  Q  G  K  A  P  R  P  G |   P  R  A  R  Q  P      p.3240

          .         .         .         .         .         .       g.124767
 CAGTCTCCACCCAGAACCAGAGAGTCCCCCCCAACCCGGGATGTACCCTCTGGCCACACC       c.9780
 Q  S  P  P  R  T  R  E  S  P  P  T  R  D  V  P  S  G  H  T         p.3260

          .         .         .         .         .          | 46    g.125572
 AGGGACCCTGCCAGAGGCCGCAGACTGGCAGCAGCAGCCTCCCCACACAGTGGGGGAAG | A    c.9840
 R  D  P  A  R  G  R  R  L  A  A  A  A  S  P  H  S  G  G  R  |      p.3280

          .         .         .         .         .         .       g.125632
 GCCACTCCATCCCCAAATTCAAGATTAGAAAGATCCCTGACTGCTTCTCAAGATCCAGAA       c.9900
 A  T  P  S  P  N  S  R  L  E  R  S  L  T  A  S  Q  D  P  E         p.3300

          .         .         .         .         .         .       g.125692
 CATTCCTTGACAGAGTATATTCACCATTTAGAAGTGATCCAGCAAAGATTGGGAGGGGTA       c.9960
 H  S  L  T  E  Y  I  H  H  L  E  V  I  Q  Q  R  L  G  G  V         p.3320

         | 47.         .         .         .         .              g.126214
 CTACCAG | ATTCTACTTCAAAGAAATCCTGCCACCCGATGATTAAACAGTGA             c.10011
 L  P  D |   S  T  S  K  K  S  C  H  P  M  I  K  Q  X               p.3336

          .         .         .         .         .         .       g.126274
 ataaaatgtcatggctctttcctgcgacaattctatttgaggaaaagatttgtttttccc       c.*60

          .         .         .         .         .         .       g.126334
 ttttcccaaggaagctcgtgggacagcatgggcactactcttcatgtgcggtgacaccag       c.*120

          .         .         .         .         .         .       g.126394
 cccccagatgccttgaattaagtgtcctcacctttatgcatgactgcaaagccagctgga       c.*180

          .         .         .         .         .         .       g.126454
 gcattttctatggagcctccgtatgttttaggcccatgaccttcgtgaggtgacgggcac       c.*240

          .         .         .         .         .         .       g.126514
 tcactcccatgagccctggctgtgtgctgttgtgtgcctatcggcagatccatccttcct       c.*300

          .         .         .         .         .         .       g.126574
 gcctccaaggaggatacacagagaatggcttcctgttgttttgtttattttcttaacgtg       c.*360

          .         .         .         .         .         .       g.126634
 tacagatggaaacttcatttaaaaataaaaacaaaacaactcaaaaaggaataaaattta       c.*420

          .         .                                               g.126656
 atcactgttttgtttgtgaata                                             c.*442

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Pericentrin protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.2.0 Build 25
©2004-2010 Leiden University Medical Center