L1 cell adhesion molecule (L1CAM) - coding DNA reference sequence

(used for mutation description)

(last modified July 30, 2009)


This file was created to facilitate the description of sequence variants in the L1CAM gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_009645.1


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                     .         .         .         .                g.5048
             tgcccccactcccaactcccgccccaagccgcccaccagcccccttcc       c.-61

 .         .         .         .         .         .                g.5108
 cctccggccggagcctgaaccgagcccggctggctgtgctgcgcggtgccgccgggaaag       c.-1

          .         .         .         .         .         .       g.5168
 ATGGTCGTGGCGCTGCGGTACGTGTGGCCTCTCCTCCTCTGCAGCCCCTGCCTGCTTATC       c.60
 M  V  V  A  L  R  Y  V  W  P  L  L  L  C  S  P  C  L  L  I         p.20

          .       | 02 .         .  | 03      .         .         . g.8276
 CAGATCCCCGAGGAAT | ATGAAGGACACCATG | TGATGGAGCCACCTGTCATCACGGAACAG c.120
 Q  I  P  E  E  Y |   E  G  H  H  V |   M  E  P  P  V  I  T  E  Q   p.40

          .         .         .         .         .         .       g.8336
 TCTCCACGGCGCCTGGTTGTCTTCCCCACAGATGACATCAGCCTCAAGTGTGAGGCCAGT       c.180
 S  P  R  R  L  V  V  F  P  T  D  D  I  S  L  K  C  E  A  S         p.60

          .        | 04.         .         .         .         .    g.8633
 GGCAAGCCCGAAGTGCA | GTTCCGCTGGACGAGGGATGGTGTCCACTTCAAACCCAAGGAA    c.240
 G  K  P  E  V  Q  |  F  R  W  T  R  D  G  V  H  F  K  P  K  E      p.80

          .         .         .         .         .         .       g.8693
 GAGCTGGGTGTGACCGTGTACCAGTCGCCCCACTCTGGCTCCTTCACCATCACGGGCAAC       c.300
 E  L  G  V  T  V  Y  Q  S  P  H  S  G  S  F  T  I  T  G  N         p.100

          .         .         .         .         .         .       g.8753
 AACAGCAACTTTGCTCAGAGGTTCCAGGGCATCTACCGCTGCTTTGCCAGCAATAAGCTG       c.360
 N  S  N  F  A  Q  R  F  Q  G  I  Y  R  C  F  A  S  N  K  L         p.120

          .         .         .         . | 05       .         .    g.9785
 GGCACCGCCATGTCCCATGAGATCCGGCTCATGGCCGAGG | GTGCCCCCAAGTGGCCAAAG    c.420
 G  T  A  M  S  H  E  I  R  L  M  A  E  G |   A  P  K  W  P  K      p.140

          .         .         .         .         .         .       g.9845
 GAGACAGTGAAGCCCGTGGAGGTGGAGGAAGGGGAGTCAGTGGTTCTGCCTTGCAACCCT       c.480
 E  T  V  K  P  V  E  V  E  E  G  E  S  V  V  L  P  C  N  P         p.160

          .         .         .         .    | 06    .         .    g.10001
 CCCCCAAGTGCAGAGCCTCTCCGGATCTACTGGATGAACAGCA | AGATCTTGCACATCAAG    c.540
 P  P  S  A  E  P  L  R  I  Y  W  M  N  S  K |   I  L  H  I  K      p.180

          .         .         .         .         .         .       g.10061
 CAGGACGAGCGGGTGACGATGGGCCAGAACGGCAACCTCTACTTTGCCAATGTGCTCACC       c.600
 Q  D  E  R  V  T  M  G  Q  N  G  N  L  Y  F  A  N  V  L  T         p.200

          .         .         .         .         .         .       g.10121
 TCCGACAACCACTCAGACTACATCTGCCACGCCCACTTCCCAGGCACCAGGACCATCATT       c.660
 S  D  N  H  S  D  Y  I  C  H  A  H  F  P  G  T  R  T  I  I         p.220

          .         .         .     | 07   .         .         .    g.10471
 CAGAAGGAACCCATTGACCTCCGGGTCAAGGCCA | CCAACAGCATGATTGACAGGAAGCCG    c.720
 Q  K  E  P  I  D  L  R  V  K  A  T |   N  S  M  I  D  R  K  P      p.240

          .         .         .         .         .         .       g.10531
 CGCCTGCTCTTCCCCACCAACTCCAGCAGCCACCTGGTGGCCTTGCAGGGGCAGCCATTG       c.780
 R  L  L  F  P  T  N  S  S  S  H  L  V  A  L  Q  G  Q  P  L         p.260

          .         .       | 08 .         .         .         .    g.10738
 GTCCTGGAGTGCATCGCCGAGGGCTT | TCCCACGCCCACCATCAAATGGCTGCGCCCCAGT    c.840
 V  L  E  C  I  A  E  G  F  |  P  T  P  T  I  K  W  L  R  P  S      p.280

          .         .         .         .         .         .       g.10798
 GGCCCCATGCCAGCCGACCGTGTCACCTACCAGAACCACAACAAGACCCTGCAGCTGCTG       c.900
 G  P  M  P  A  D  R  V  T  Y  Q  N  H  N  K  T  L  Q  L  L         p.300

          .         .         .         .         .         .       g.10858
 AAAGTGGGCGAGGAGGATGATGGCGAGTACCGCTGCCTGGCCGAGAACTCACTGGGCAGT       c.960
 K  V  G  E  E  D  D  G  E  Y  R  C  L  A  E  N  S  L  G  S         p.320

          .         .         .  | 09      .         .         .    g.11039
 GCCCGGCATGCGTACTATGTCACCGTGGAGG | CTGCCCCGTACTGGCTGCACAAGCCCCAG    c.1020
 A  R  H  A  Y  Y  V  T  V  E  A |   A  P  Y  W  L  H  K  P  Q      p.340

          .         .         .         .         .         .       g.11099
 AGCCATCTATATGGGCCAGGAGAGACTGCCCGCCTGGACTGCCAAGTCCAGGGCAGGCCC       c.1080
 S  H  L  Y  G  P  G  E  T  A  R  L  D  C  Q  V  Q  G  R  P         p.360

          .         .         .         .    | 10    .         .    g.11298
 CAACCAGAGGTCACCTGGAGAATCAACGGGATCCCTGTGGAGG | AGCTGGCCAAAGACCAG    c.1140
 Q  P  E  V  T  W  R  I  N  G  I  P  V  E  E |   L  A  K  D  Q      p.380

          .         .         .         .         .         .       g.11358
 AAGTACCGGATTCAGCGTGGCGCCCTGATCCTGAGCAACGTGCAGCCCAGTGACACAATG       c.1200
 K  Y  R  I  Q  R  G  A  L  I  L  S  N  V  Q  P  S  D  T  M         p.400

          .         .         .         .         .         .       g.11418
 GTGACCCAATGTGAGGCCCGCAACCGGCACGGGCTCTTGCTGGCCAATGCCTACATCTAC       c.1260
 V  T  Q  C  E  A  R  N  R  H  G  L  L  L  A  N  A  Y  I  Y         p.420

         | 11.         .         .         .         .         .    g.12045
 GTTGTCC | AGCTGCCAGCCAAGATCCTGACTGCGGACAATCAGACGTACATGGCTGTCCAG    c.1320
 V  V  Q |   L  P  A  K  I  L  T  A  D  N  Q  T  Y  M  A  V  Q      p.440

          .         .         .         .         .          | 12    g.12218
 GGCAGCACTGCCTACCTTCTGTGCAAGGCCTTCGGAGCGCCTGTGCCCAGTGTTCAGTG | G    c.1380
 G  S  T  A  Y  L  L  C  K  A  F  G  A  P  V  P  S  V  Q  W  |      p.460

          .         .         .         .         .         .       g.12278
 CTGGACGAGGATGGGACAACAGTGCTTCAGGACGAACGCTTCTTCCCCTATGCCAATGGG       c.1440
 L  D  E  D  G  T  T  V  L  Q  D  E  R  F  F  P  Y  A  N  G         p.480

          .         .         .         .         .         .       g.12338
 ACCCTGGGCATTCGAGACCTCCAGGCCAATGACACCGGACGCTACTTCTGCCTGGCTGCC       c.1500
 T  L  G  I  R  D  L  Q  A  N  D  T  G  R  Y  F  C  L  A  A         p.500

          .         .         .         .       | 13 .         .    g.12500
 AATGACCAAAACAATGTTACCATCATGGCTAACCTGAAGGTTAAAG | ATGCAACTCAGATC    c.1560
 N  D  Q  N  N  V  T  I  M  A  N  L  K  V  K  D |   A  T  Q  I      p.520

          .         .         .         .         .         .       g.12560
 ACTCAGGGGCCCCGCAGCACAATCGAGAAGAAAGGTTCCAGGGTGACCTTCACGTGCCAG       c.1620
 T  Q  G  P  R  S  T  I  E  K  K  G  S  R  V  T  F  T  C  Q         p.540

          .         .         .         .         .         .       g.12620
 GCCTCCTTTGACCCCTCCTTGCAGCCCAGCATCACCTGGCGTGGGGACGGTCGAGACCTC       c.1680
 A  S  F  D  P  S  L  Q  P  S  I  T  W  R  G  D  G  R  D  L         p.560

          .         .    | 14    .         .         .         .    g.12859
 CAGGAGCTTGGGGACAGTGACAA | GTACTTCATAGAGGATGGGCGCCTGGTCATCCACAGC    c.1740
 Q  E  L  G  D  S  D  K  |  Y  F  I  E  D  G  R  L  V  I  H  S      p.580

          .         .         .         .         .         .       g.12919
 CTGGACTACAGCGACCAGGGCAACTACAGCTGCGTGGCCAGTACCGAACTGGATGTGGTG       c.1800
 L  D  Y  S  D  Q  G  N  Y  S  C  V  A  S  T  E  L  D  V  V         p.600

          .         .         | 15         .         .         .    g.13066
 GAGAGTAGGGCACAGCTCTTGGTGGTGG | GGAGCCCTGGGCCGGTGCCACGGCTGGTGCTG    c.1860
 E  S  R  A  Q  L  L  V  V  G |   S  P  G  P  V  P  R  L  V  L      p.620

          .         .         .         .         .         .       g.13126
 TCCGACCTGCACCTGCTGACGCAGAGCCAGGTGCGCGTGTCCTGGAGTCCTGCAGAAGAC       c.1920
 S  D  L  H  L  L  T  Q  S  Q  V  R  V  S  W  S  P  A  E  D         p.640

          .          | 16        .         .         .         .    g.13432
 CACAATGCCCCCATTGAGA | AATATGACATTGAATTTGAGGACAAGGAAATGGCGCCTGAA    c.1980
 H  N  A  P  I  E  K |   Y  D  I  E  F  E  D  K  E  M  A  P  E      p.660

          .         .         .         .         .         .       g.13492
 AAATGGTACAGTCTGGGCAAGGTTCCAGGGAACCAGACCTCTACCACCCTCAAGCTGTCG       c.2040
 K  W  Y  S  L  G  K  V  P  G  N  Q  T  S  T  T  L  K  L  S         p.680

          .         .         .         .         .         .       g.13552
 CCCTATGTCCACTACACCTTTAGGGTTACTGCCATAAACAAATATGGCCCCGGGGAGCCC       c.2100
 P  Y  V  H  Y  T  F  R  V  T  A  I  N  K  Y  G  P  G  E  P         p.700

          .         .         .        | 17.         .         .    g.13843
 AGCCCGGTCTCTGAGACTGTGGTCACACCTGAGGCAG | CCCCAGAGAAGAACCCTGTGGAT    c.2160
 S  P  V  S  E  T  V  V  T  P  E  A  A |   P  E  K  N  P  V  D      p.720

          .         .         .         .         | 18         .    g.14085
 GTGAAGGGGGAAGGAAATGAGACCACCAATATGGTCATCACGTGGAAG | CCGCTCCGGTGG    c.2220
 V  K  G  E  G  N  E  T  T  N  M  V  I  T  W  K   | P  L  R  W      p.740

          .         .         .         .         .         .       g.14145
 ATGGACTGGAACGCCCCCCAGGTTCAGTACCGCGTGCAGTGGCGCCCTCAGGGGACACGA       c.2280
 M  D  W  N  A  P  Q  V  Q  Y  R  V  Q  W  R  P  Q  G  T  R         p.760

          .         .         .         .         .         .       g.14205
 GGGCCCTGGCAGGAGCAGATTGTCAGCGACCCCTTCCTGGTGGTGTCCAACACGTCCACC       c.2340
 G  P  W  Q  E  Q  I  V  S  D  P  F  L  V  V  S  N  T  S  T         p.780

          .         .         .         .         .         .       g.14265
 TTCGTGCCCTATGAGATCAAAGTCCAGGCCGTCAACAGCCAGGGCAAGGGACCAGAGCCC       c.2400
 F  V  P  Y  E  I  K  V  Q  A  V  N  S  Q  G  K  G  P  E  P         p.800

          .         .         .  | 19      .         .         .    g.15154
 CAGGTCACTATCGGCTACTCTGGAGAGGACT | ACCCCCAGGCAATCCCTGAGCTGGAAGGC    c.2460
 Q  V  T  I  G  Y  S  G  E  D  Y |   P  Q  A  I  P  E  L  E  G      p.820

          .         .         .         .         .         .       g.15214
 ATTGAAATCCTCAACTCAAGTGCCGTGCTGGTCAAGTGGCGGCCGGTGGACCTGGCCCAG       c.2520
 I  E  I  L  N  S  S  A  V  L  V  K  W  R  P  V  D  L  A  Q         p.840

          .         .        | 20.         .         .         .    g.15477
 GTCAAGGGCCACCTCCGCGGATACAAT | GTGACGTACTGGAGGGAGGGCAGTCAGAGGAAG    c.2580
 V  K  G  H  L  R  G  Y  N   | V  T  Y  W  R  E  G  S  Q  R  K      p.860

          .         .         .         .         .         .       g.15537
 CACAGCAAGAGACATATCCACAAAGACCATGTGGTGGTGCCCGCCAACACCACCAGTGTC       c.2640
 H  S  K  R  H  I  H  K  D  H  V  V  V  P  A  N  T  T  S  V         p.880

          .         .         .         .         .         .       g.15597
 ATCCTCAGTGGCTTGCGGCCCTATAGCTCCTACCACCTGGAGGTGCAGGCCTTTAACGGG       c.2700
 I  L  S  G  L  R  P  Y  S  S  Y  H  L  E  V  Q  A  F  N  G         p.900

          .         .         .         .          | 21        .    g.15745
 CGAGGATCGGGGCCCGCCAGCGAGTTCACCTTCAGCACCCCAGAGGGAG | TGCCTGGCCAC    c.2760
 R  G  S  G  P  A  S  E  F  T  F  S  T  P  E  G  V |   P  G  H      p.920

          .         .         .         .         .         .       g.15805
 CCCGAGGCGTTGCACCTGGAGTGCCAGTCGAACACCAGCCTGCTGCTGCGCTGGCAGCCC       c.2820
 P  E  A  L  H  L  E  C  Q  S  N  T  S  L  L  L  R  W  Q  P         p.940

          .         .         .         .         .   | 22     .    g.15958
 CCACTCAGCCACAACGGCGTGCTCACCGGCTACGTGCTCTCCTACCACCCCC | TGGATGAG    c.2880
 P  L  S  H  N  G  V  L  T  G  Y  V  L  S  Y  H  P  L |   D  E      p.960

          .         .         .         .         .         .       g.16018
 GGGGGCAAGGGGCAACTGTCCTTCAACCTTCGGGACCCCGAACTTCGGACACACAACCTG       c.2940
 G  G  K  G  Q  L  S  F  N  L  R  D  P  E  L  R  T  H  N  L         p.980

          .         .         .         .         .         .       g.16078
 ACCGATCTCAGCCCCCACCTGCGGTACCGCTTCCAGCTTCAGGCCACCACCAAAGAGGGC       c.3000
 T  D  L  S  P  H  L  R  Y  R  F  Q  L  Q  A  T  T  K  E  G         p.1000

          .         .         .         .       | 23 .         .    g.16254
 CCTGGTGAAGCCATCGTACGGGAAGGAGGCACTATGGCCTTGTCTG | GGATCTCAGATTTT    c.3060
 P  G  E  A  I  V  R  E  G  G  T  M  A  L  S  G |   I  S  D  F      p.1020

          .         .         .         .         .         .       g.16314
 GGCAACATCTCAGCCACAGCGGGTGAAAACTACAGTGTCGTCTCCTGGGTCCCCAAGGAG       c.3120
 G  N  I  S  A  T  A  G  E  N  Y  S  V  V  S  W  V  P  K  E         p.1040

          .         .         .         .       | 24 .         .    g.16481
 GGCCAGTGCAACTTCAGGTTCCATATCTTGTTCAAAGCCTTGGGAG | AAGAGAAGGGTGGG    c.3180
 G  Q  C  N  F  R  F  H  I  L  F  K  A  L  G  E |   E  K  G  G      p.1060

          .         .         .         .         .         .       g.16541
 GCTTCCCTTTCGCCACAGTATGTCAGCTACAACCAGAGCTCCTACACGCAGTGGGACCTG       c.3240
 A  S  L  S  P  Q  Y  V  S  Y  N  Q  S  S  Y  T  Q  W  D  L         p.1080

          .         .         .         .         .         .       g.16601
 CAGCCTGACACTGACTACGAGATCCACTTGTTTAAGGAGAGGATGTTCCGGCACCAAATG       c.3300
 Q  P  D  T  D  Y  E  I  H  L  F  K  E  R  M  F  R  H  Q  M         p.1100

          .         .   | 25     .         .         .         .    g.16965
 GCTGTGAAGACCAATGGCACAG | GCCGCGTGAGGCTCCCTCCTGCTGGCTTCGCCACTGAG    c.3360
 A  V  K  T  N  G  T  G |   R  V  R  L  P  P  A  G  F  A  T  E      p.1120

          .         .         .         .         .         .       g.17025
 GGCTGGTTCATCGGCTTTGTGAGTGCCATCATCCTCCTGCTCCTCGTCCTGCTCATCCTC       c.3420
 G  W  F  I  G  F  V  S  A  I  I  L  L  L  L  V  L  L  I  L         p.1140

          .         .         .        | 26.         .         .    g.17418
 TGCTTCATCAAGCGCAGCAAGGGCGGCAAATACTCAG | TGAAGGATAAGGAGGACACCCAG    c.3480
 C  F  I  K  R  S  K  G  G  K  Y  S  V |   K  D  K  E  D  T  Q      p.1160

          .         .         .         .         . | 27       .    g.17575
 GTGGACTCTGAGGCCCGACCGATGAAAGATGAGACCTTCGGCGAGTACAG | GTCCCTGGAG    c.3540
 V  D  S  E  A  R  P  M  K  D  E  T  F  G  E  Y  R  |  S  L  E      p.1180

    | 28     .         .         .         .         .         .    g.18108
 AG | TGACAACGAGGAGAAGGCCTTTGGCAGCAGCCAGCCATCGCTCAACGGGGACATCAAG    c.3600
 S  |  D  N  E  E  K  A  F  G  S  S  Q  P  S  L  N  G  D  I  K      p.1200

          .         .         .         .         .         .       g.18168
 CCCCTGGGCAGTGACGACAGCCTGGCCGATTATGGGGGCAGCGTGGATGTTCAGTTCAAC       c.3660
 P  L  G  S  D  D  S  L  A  D  Y  G  G  S  V  D  V  Q  F  N         p.1220

          .         .         .         .         .         .       g.18228
 GAGGATGGTTCGTTCATTGGCCAGTACAGTGGCAAGAAGGAGAAGGAGGCGGCAGGGGGC       c.3720
 E  D  G  S  F  I  G  Q  Y  S  G  K  K  E  K  E  A  A  G  G         p.1240

          .         .         .         .         .                 g.18282
 AATGACAGCTCAGGGGCCACTTCCCCCATCAACCCTGCCGTGGCCCTAGAATAG             c.3774
 N  D  S  S  G  A  T  S  P  I  N  P  A  V  A  L  E  X               p.1257

          .         .         .         .         .         .       g.18342
 tggagtccaggacaggagatgctgtgcccctggccttgggatccaggcccctccctctcc       c.*60

          .         .         .         .         .         .       g.18402
 agcaggcccatgggaggctggagttggggcagaggagaacttgctgcctcggatcccctt       c.*120

          .         .         .         .         .         .       g.18462
 cctaccacccggtccccactttattgccaaaacccagctgcaccccttcctgggcacacg       c.*180

          .         .         .         .         .         .       g.18522
 ctgctctgccccagcttgggcagatctcccacatgccaggggcctttgggtgctgttttg       c.*240

          .         .         .         .         .         .       g.18582
 ccagcccatttgggcagagaggctgtggtttgggggagaagaagtaggggtggcccgaaa       c.*300

          .         .         .         .         .         .       g.18642
 gggtctccgaaatgctgtctttcttgctccctgactgggggcagacatggtggggtctcc       c.*360

          .         .         .         .         .         .       g.18702
 tcaggaccagggttggcaccttccccctcccccagccactccccagccagcctggctggg       c.*420

          .         .         .         .         .         .       g.18762
 actgggaacagaactcggtgtccccaccatctgctgtcttttctttgccatctctgctcc       c.*480

          .         .         .         .         .         .       g.18822
 aaccgggatgggagccgggcaaactggccgcgggggcaggggaggccatctggagagccc       c.*540

          .         .         .         .         .         .       g.18882
 agagtccccccactcccagcatcgcactctggcagcaccgcctcttcccgccgcccagcc       c.*600

          .         .         .         .         .         .       g.18942
 caccccatggccggctttcaggagctccatacacacgctgccttcggtacccaccacaca       c.*660

          .         .         .         .         .         .       g.19002
 acatccaagtggcctccgtcactacctggctgcggggcgggcacacctcctcccactgcc       c.*720

          .         .         .         .         .         .       g.19062
 cactggccggcctcttccagccgcccccaccccccaggaccccttagcagccctgccctc       c.*780

          .         .         .         .         .         .       g.19122
 cctatcgtctgaacagttgtcttcctcagcctcctcccgcccccaccttgggaatgtaaa       c.*840

          .         .         .         .         .         .       g.19182
 tacaccgtgactttgaaagtttgtacccctgtccttccctttacgccactagtgtgtagg       c.*900

          .         .         .         .         .         .       g.19242
 cagatgtctgagtccctaggtggtttctaggattgatagcaattagctttgatgaaccca       c.*960

          .         .         .         .         .         .       g.19302
 tcccaggaaaaataaaaacagacaaaaaaaaaggaaagattggttctcccagcactgctc       c.*1020

          .         .         .         .         .         .       g.19362
 agcagccacagcctccctgtatgcctgtgcttggtctactgataagccctctacaaaaaa       c.*1080

          .         .         .         .         .         .       g.19422
 acaaaagtatatatatatatgtacataatatcagaattataacaggcaaataaaacctga       c.*1140

                                                                    g.19429
 aaatcaa                                                            c.*1147

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The L1 cell adhesion molecule protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVDv.2.0-20 Build 20
©2004-2009 Leiden University Medical Center