inter-alpha-trypsin inhibitor heavy chain family, member 6 (ITIH6) - coding DNA reference sequence

(used for mutation description)

(last modified January 28, 2012)


This file was created to facilitate the description of sequence variants in the ITIH6 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_013240.1, covering ITIH6 transcript NM_198510.2.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                               .         .         .                g.5030
                               gaacaacagatccaggccagaggtggcatc       c.-1

          .         .         .         .         .         .       g.5090
 ATGTCTGGGTGGAGGTACCTCATCTGTGTCAGCTTTTTGCTGACCATTCTTCTTGAACTG       c.60
 M  S  G  W  R  Y  L  I  C  V  S  F  L  L  T  I  L  L  E  L         p.20

          .         .         .         .   | 02     .         .    g.6162
 ACATACCAGGGACCCCCTGTCCCCGCTTCATCAAGCACAAAG | TTGTTAATGACAAGCTAT    c.120
 T  Y  Q  G  P  P  V  P  A  S  S  S  T  K   | L  L  M  T  S  Y      p.40

          .         .         .         .         .         .       g.6222
 TCTATGCGCTCCACGGTGGTGTCTCGCTATGCCCACACCTTGGTCACCTCTGTCCTGTTT       c.180
 S  M  R  S  T  V  V  S  R  Y  A  H  T  L  V  T  S  V  L  F         p.60

          .         .         .         .         .         .       g.6282
 AATCCACATGCTGAAGCCCATGAAGCCATCTTTGACCTGGATCTGCCTCATCTTGCCTTT       c.240
 N  P  H  A  E  A  H  E  A  I  F  D  L  D  L  P  H  L  A  F         p.80

          .        | 03.         .         .         .         .    g.11247
 ATCTCCAATTTCACTAT | GACCATCAACAATAAAGTCTACATTGCAGAAGTCAAAGAGAAG    c.300
 I  S  N  F  T  M  |  T  I  N  N  K  V  Y  I  A  E  V  K  E  K      p.100

          .         .         .         .         .         .       g.11307
 CACCAGGCAAAGAAAATCTATGAAGAAGCCCATCAGCAGGGAAAGACAGCTGCTCATGTA       c.360
 H  Q  A  K  K  I  Y  E  E  A  H  Q  Q  G  K  T  A  A  H  V         p.120

          | 04         .         .         .         .         .    g.12208
 GGCATCAG | GGACCGGGAATCAGAGAAGTTCCGCATCTCCACCAGCCTGGCAGCAGGCACA    c.420
 G  I  R  |  D  R  E  S  E  K  F  R  I  S  T  S  L  A  A  G  T      p.140

          .         .         .         .         .         .       g.12268
 GAGGTGACTTTTTCCCTGGCCTATGAGGAACTGCTTCAGCGGCACCAGGGCCAGTACCAG       c.480
 E  V  T  F  S  L  A  Y  E  E  L  L  Q  R  H  Q  G  Q  Y  Q         p.160

          .         .         .         .         .         .       g.12328
 CTGGTGGTGAGCCTGAGGCCTGGCCAATTGGTGAAGAGGCTGAGCATAGAGGTTACAGTG       c.540
 L  V  V  S  L  R  P  G  Q  L  V  K  R  L  S  I  E  V  T  V         p.180

          .         .         .         .         .         .       g.12388
 TCAGAAAGGACAGGCATCTCCTATGTGCACATACCACCCCTGAGGACCGGCCGTCTGCGC       c.600
 S  E  R  T  G  I  S  Y  V  H  I  P  P  L  R  T  G  R  L  R         p.200

          .       | 05 .         .         .         .         .    g.14635
 ACCAATGCCCATGCAA | GTGAGGTGGATTCACCCCCATCCACCAGGATCGAGAGGGGAGAG    c.660
 T  N  A  H  A  S |   E  V  D  S  P  P  S  T  R  I  E  R  G  E      p.220

          .         .         .         .         .         .       g.14695
 ACCTGTGTCCGAATCACCTACTGCCCGACATTGCAAGACCAGTCGTCCATCTCTGGGTCA       c.720
 T  C  V  R  I  T  Y  C  P  T  L  Q  D  Q  S  S  I  S  G  S         p.240

          .         .         .         .         .         .       g.14755
 GGCATCATGGCTGACTTCCTGGTTCAGTACGATGTGGTCATGGAGGACATCATTGGAGAC       c.780
 G  I  M  A  D  F  L  V  Q  Y  D  V  V  M  E  D  I  I  G  D         p.260

        | 06 .         .         .         .         .         .    g.29097
 GTGCAG | ATTTACGATGACTATTTCATTCACTACTTTGCCCCCAGAGGCCTTCCACCTATG    c.840
 V  Q   | I  Y  D  D  Y  F  I  H  Y  F  A  P  R  G  L  P  P  M      p.280

          .         .         .         .         .         .       g.29157
 GAGAAGAATGTGGTTTTTGTTATTGACGTAAGCAGCTCCATGTTTGGTACCAAGATGGAA       c.900
 E  K  N  V  V  F  V  I  D  V  S  S  S  M  F  G  T  K  M  E         p.300

     | 07    .         .         .         .         .         .    g.43370
 CAG | ACTAAAACGGCCATGAATGTGATCCTCAGTGACCTTCAAGCCAATGACTACTTCAAC    c.960
 Q   | T  K  T  A  M  N  V  I  L  S  D  L  Q  A  N  D  Y  F  N      p.320

          .         .         .         .         .         .       g.43430
 ATCATCTCCTTTTCTGACACAGTTAATGTTTGGAAAGCTGGAGGCTCAATCCAGGCCACC       c.1020
 I  I  S  F  S  D  T  V  N  V  W  K  A  G  G  S  I  Q  A  T         p.340

          .         .         .         .         .      | 08  .    g.44247
 ATCCAGAATGTCCACAGTGCCAAGGACTACCTGCATTGCATGGAAGCCGATGGCT | GGACA    c.1080
 I  Q  N  V  H  S  A  K  D  Y  L  H  C  M  E  A  D  G  W |   T      p.360

          .         .         .         .         .         .       g.44307
 GACGTCAACTCAGCTCTGCTGGCAGCTGCTTCAGTGCTGAACCATAGCAACCAGGAGCCT       c.1140
 D  V  N  S  A  L  L  A  A  A  S  V  L  N  H  S  N  Q  E  P         p.380

          .         .         .         .         .         .       g.44367
 GGGAGGGGCCCCAGTGTGGGGAGGATCCCTCTTATCATCTTCCTGACGGATGGGGAGCCC       c.1200
 G  R  G  P  S  V  G  R  I  P  L  I  I  F  L  T  D  G  E  P         p.400

          .         .         .         .         .         .       g.44427
 ACGGCCGGCGTGACGACCCCCAGTGTGATCCTCTCCAATGTCCGTCAGGCGCTAGGCCAC       c.1260
 T  A  G  V  T  T  P  S  V  I  L  S  N  V  R  Q  A  L  G  H         p.420

          .         .         .         .         .         .       g.44487
 AGGGTATCCCTTTTCAGCTTGGCCTTTGGGGATGATGCTGACTTTACACTGCTGCGCCGC       c.1320
 R  V  S  L  F  S  L  A  F  G  D  D  A  D  F  T  L  L  R  R         p.440

          .         .         .         .         .         .       g.44547
 CTGTCCCTGGAAAACCGGGGAATAGCCCGGCGCATATATGAGGACACTGATGCGGCCCTA       c.1380
 L  S  L  E  N  R  G  I  A  R  R  I  Y  E  D  T  D  A  A  L         p.460

          .         .         .         .         .         .       g.44607
 CAGCTGAAGGGCCTCTATGAGGAGATCTCCATGCCTCTGCTGGCAGATGTGCGTCTGAAC       c.1440
 Q  L  K  G  L  Y  E  E  I  S  M  P  L  L  A  D  V  R  L  N         p.480

          .         .         .         .         .         .       g.44667
 TACCTGGGTGGCTTGGTTGGGGCCTCCCCTTGGGCCGTTTTCCCCAACTACTTTGGTGGC       c.1500
 Y  L  G  G  L  V  G  A  S  P  W  A  V  F  P  N  Y  F  G  G         p.500

          .         .         .         .         .         .       g.44727
 TCTGAGCTGGTGGTGGCAGGACAGGTGCAGCCAGGCAAACAGGAACTGGGCATCCACCTG       c.1560
 S  E  L  V  V  A  G  Q  V  Q  P  G  K  Q  E  L  G  I  H  L         p.520

          .         .         .         .         .         .       g.44787
 GCAGCCCGTGGCCCCAAGGATCAGCTTCTTGTGGCCCACCACAGTGAAGGGGCCACCAAC       c.1620
 A  A  R  G  P  K  D  Q  L  L  V  A  H  H  S  E  G  A  T  N         p.540

          .         .         .         .         .         .       g.44847
 AACAGCCAGAAGGCCTTTGGTTGCCCAGGGGAGCCAGCCCCCAATGTGGCCCACTTCATC       c.1680
 N  S  Q  K  A  F  G  C  P  G  E  P  A  P  N  V  A  H  F  I         p.560

          .         .         .         .         .         .       g.44907
 CGCCGCCTCTGGGCCTATGTCACCATTGGAGAACTGCTGGATGCACACTTCCAAGCTCGT       c.1740
 R  R  L  W  A  Y  V  T  I  G  E  L  L  D  A  H  F  Q  A  R         p.580

          .         .         .         .         .         .       g.44967
 GACACCACCACTCGCCACCTGCTGGCTGCCAAAGTCCTCAACCTGTCCCTTGAATACAAC       c.1800
 D  T  T  T  R  H  L  L  A  A  K  V  L  N  L  S  L  E  Y  N         p.600

          .         .         .         .         .         .       g.45027
 TTTGTCACACCTCTGACTTCACTGGTCATGGTGCAACCCAAACAGGCCAGTGAGGAGACC       c.1860
 F  V  T  P  L  T  S  L  V  M  V  Q  P  K  Q  A  S  E  E  T         p.620

          .         .         .         .         .         .       g.45087
 AGGAGACAGACTTCCACCTCTGCTGGGCCAGACACCATCATGCCCTCATCCAGCAGCAGG       c.1920
 R  R  Q  T  S  T  S  A  G  P  D  T  I  M  P  S  S  S  S  R         p.640

          .         .         .         .         .         .       g.45147
 CATGGCCTAGGGGTAAGCACAGCTCAGCCAGCCTTGGTGCCCAAGGTCATCTCCCCCAAA       c.1980
 H  G  L  G  V  S  T  A  Q  P  A  L  V  P  K  V  I  S  P  K         p.660

          .         .         .         .         .         .       g.45207
 TCAAGGCCTGTGAAACCAAAGTTCTACTTATCCTCAACTACTACTGCCTCTACCAAGAAG       c.2040
 S  R  P  V  K  P  K  F  Y  L  S  S  T  T  T  A  S  T  K  K         p.680

          .         .         .         .         .         .       g.45267
 ATGCTAAGTTCCAAAGAGCTGGAGCCATTGGGAGAGAGCCCTCATACCCTGTCAATGCCC       c.2100
 M  L  S  S  K  E  L  E  P  L  G  E  S  P  H  T  L  S  M  P         p.700

          .         .         .         .         .         .       g.45327
 ACATACCCAAAGGCCAAAATTCCAGCACAACAGGATTCTGGCACCTTGGCCCAGCCAACT       c.2160
 T  Y  P  K  A  K  I  P  A  Q  Q  D  S  G  T  L  A  Q  P  T         p.720

          .         .         .         .         .         .       g.45387
 CTCAGGACAAAACCTACCATTCTTGTGCCCTCAAATTCTGGTACTCTGTTGCCTCTGAAG       c.2220
 L  R  T  K  P  T  I  L  V  P  S  N  S  G  T  L  L  P  L  K         p.740

          .         .         .         .         .         .       g.45447
 CCCGGCTCTCTATCACACCAGAATCCTGATATATTACCCACGAACTCCAGGACACAAGTC       c.2280
 P  G  S  L  S  H  Q  N  P  D  I  L  P  T  N  S  R  T  Q  V         p.760

          .         .         .         .         .         .       g.45507
 CCACCTGTGAAACCTGGCATCCCAGCCTCGCCCAAAGCTGACACTGTGAAATGTGTTACT       c.2340
 P  P  V  K  P  G  I  P  A  S  P  K  A  D  T  V  K  C  V  T         p.780

          .         .         .         .         .         .       g.45567
 CCACTGCATTCCAAACCTGGTGCTCCATCGCACCCCCAACTTGGGGCACTCACATCACAG       c.2400
 P  L  H  S  K  P  G  A  P  S  H  P  Q  L  G  A  L  T  S  Q         p.800

          .         .         .         .         .         .       g.45627
 GCACCTAAAGGCCTGCCACAGTCAAGACCTGGAGTCTCTACACTTCAGGTTCCCAAGTAC       c.2460
 A  P  K  G  L  P  Q  S  R  P  G  V  S  T  L  Q  V  P  K  Y         p.820

          .         .         .         .         .         .       g.45687
 CCACTACACACCAGACCTAGGGTTCCTGCTCCCAAGACCCGAAACAACATGCCACACCTG       c.2520
 P  L  H  T  R  P  R  V  P  A  P  K  T  R  N  N  M  P  H  L         p.840

          .         .         .         .         .         .       g.45747
 GGGCCTGGAATCCTCTTGTCCAAGACCCCTAAAATCTTATTATCTCTTAAACCGAGTGCC       c.2580
 G  P  G  I  L  L  S  K  T  P  K  I  L  L  S  L  K  P  S  A         p.860

          .         .         .         .         .         .       g.45807
 CCACCACACCAAATTTCCACAAGCATATCACTTTCCAAGCCTGAGACCCCAAACCCCCAT       c.2640
 P  P  H  Q  I  S  T  S  I  S  L  S  K  P  E  T  P  N  P  H         p.880

          .         .         .         .         .         .       g.45867
 ATGCCTCAAACCCCACTACCTCCTAGACCTGACAGACCAAGGCCCCCACTTCCTGAGAGC       c.2700
 M  P  Q  T  P  L  P  P  R  P  D  R  P  R  P  P  L  P  E  S         p.900

          .         .         .         .         .         .       g.45927
 CTAAGCACATTCCCAAATACAATCTCAAGTTCCACAGGTCCCAGCAGTACCACAACCACC       c.2760
 L  S  T  F  P  N  T  I  S  S  S  T  G  P  S  S  T  T  T  T         p.920

          .         .         .         .         .         .       g.45987
 TCTGTCCTTGGAGAACCCCTCCCCATGCCCTTTACTCCCACTCTGCCCCCTGGAAGGTTC       c.2820
 S  V  L  G  E  P  L  P  M  P  F  T  P  T  L  P  P  G  R  F         p.940

          .         .         .         .         .         .       g.46047
 TGGCATCAGTATGACCTCCTCCCGGGTCCCCAGAGGACCAGGCAAGTTCTGGGACCATCT       c.2880
 W  H  Q  Y  D  L  L  P  G  P  Q  R  T  R  Q  V  L  G  P  S         p.960

          .         .         .         .         .         .       g.46107
 AGGCCAGGAGTTCCAACAATGAGCCTACTCAACAGCTCCAGGCCTACACCAGAAGGCAGC       c.2940
 R  P  G  V  P  T  M  S  L  L  N  S  S  R  P  T  P  E  G  S         p.980

          .         .         .         .         .         .       g.46167
 CCTCCAAACCTGCCAATCTTGCTGCCTTCTAGCATCCTCCCTGAGGCCATCAGTCTGCTC       c.3000
 P  P  N  L  P  I  L  L  P  S  S  I  L  P  E  A  I  S  L  L         p.1000

          .         .         .         .         .         .       g.46227
 CTTCTCCCTGAGGAGCTAGAGCTGCTGTCTGAATCAATGGTGGAATCCAAGTTCGTGGAG       c.3060
 L  L  P  E  E  L  E  L  L  S  E  S  M  V  E  S  K  F  V  E         p.1020

          .         .         .         .          | 09        .    g.48142
 TCCTTGAACCCACCAGCTTTCTATACCTTCCTCACTCCTGATGAAGATG | GAAGTCCAAAC    c.3120
 S  L  N  P  P  A  F  Y  T  F  L  T  P  D  E  D  G |   S  P  N      p.1040

          .         .         .         .         .         .       g.48202
 TGGGATGGCAATTCTGAGGAGATCCTGGGAGGAGCTGGAGGCAGCATGGAATCTCAAGGA       c.3180
 W  D  G  N  S  E  E  I  L  G  G  A  G  G  S  M  E  S  Q  G         p.1060

          .         .   | 10     .         .         .         | 11 g.49478
 AGTTCTGTGGGGTTAGCAAAAG | GCACATTGCCTAGCATCTTCACCTTCTCCTCCTCAG | TG c.3240
 S  S  V  G  L  A  K  G |   T  L  P  S  I  F  T  F  S  S  S  V |    p.1080

          .         .         .         .         .         .       g.49538
 GACGGGGACCCCCACTTTGTGATCCAAATCCCACACTCAGAAGAGAAGATCTGCTTCACA       c.3300
 D  G  D  P  H  F  V  I  Q  I  P  H  S  E  E  K  I  C  F  T         p.1100

          .         .         .         .         .   | 12     .    g.51868
 CTGAATGGGCACCCTGGGGACTTGCTGCAGCTCATAGAGGACCCAAAGGCAG | GGCTGCAT    c.3360
 L  N  G  H  P  G  D  L  L  Q  L  I  E  D  P  K  A  G |   L  H      p.1120

          .         .         .         .         .         .       g.51928
 GTGAGTGGGAAGCTGCTTGGCGCACCACCAAGGCCGGGCCACAAGGACCAGACTCGCACC       c.3420
 V  S  G  K  L  L  G  A  P  P  R  P  G  H  K  D  Q  T  R  T         p.1140

          .         .         .         .         .         .       g.51988
 TACTTCCAGATCATCACAGTCACTACAGACAAACCCCGGGCCTATACTATCACCATCAGC       c.3480
 Y  F  Q  I  I  T  V  T  T  D  K  P  R  A  Y  T  I  T  I  S         p.1160

          .         .         .         .         .         .       g.52048
 CGCAGTTCTATATCTTTGCGAGGCGAGGGTACCTTGCGCCTGTCCTGGGACCAACCTGCC       c.3540
 R  S  S  I  S  L  R  G  E  G  T  L  R  L  S  W  D  Q  P  A         p.1180

          .         .         .         .         .         .       g.52108
 CTGCTGAAGAGGCCCCAGCTGGAGCTCTATGTGGCTGCTGCAGCCCGCCTTACCCTCCGC       c.3600
 L  L  K  R  P  Q  L  E  L  Y  V  A  A  A  A  R  L  T  L  R         p.1200

          .         .         .         .         .         .       g.52168
 CTTGGGCCCTACCTTGAGTTCCTAGTCCTCCGACACCGCTACAGGCATCCCAGTACCCTG       c.3660
 L  G  P  Y  L  E  F  L  V  L  R  H  R  Y  R  H  P  S  T  L         p.1220

          .         .         .         .         .         .       g.52228
 CAACTACCCCACCTGGGGTTCTACGTGGCCAATGGCTCAGGCCTCAGCCCCTCAGCCCGT       c.3720
 Q  L  P  H  L  G  F  Y  V  A  N  G  S  G  L  S  P  S  A  R         p.1240

          . | 13       .         .         .         .         .    g.53184
 GGCCTGATAG | GGCAGTTCCAGCACGCAGACATCCGACTGGTGACAGGACCTATGGGGCCA    c.3780
 G  L  I  G |   Q  F  Q  H  A  D  I  R  L  V  T  G  P  M  G  P      p.1260

          .         .         .         .         .         .       g.53244
 TGCTTACGAAGGCACCATGGCCCAGATGTGCCTGTGATTCTAGGCAAGAGGCTGCTGAAG       c.3840
 C  L  R  R  H  H  G  P  D  V  P  V  I  L  G  K  R  L  L  K         p.1280

          .         .         .         .         .         .       g.53304
 GACTCACCAAGGCTGCTGCCCCGCTGGGCTTCCTGCTGGCTGGTGAAGCGCTCTCATGTA       c.3900
 D  S  P  R  L  L  P  R  W  A  S  C  W  L  V  K  R  S  H  V         p.1300

          .         .         .         .                           g.53346
 GAGCTGCTTCTGGGCCACCCCTACCTCTCCTATGTCCTGTGA                         c.3942
 E  L  L  L  G  H  P  Y  L  S  Y  V  L  X                           p.1313

          .         .         .         .         .         .       g.53406
 tggcttctgaattccagagccaggagacctgaatttgggagatccagaaaccagggcatg       c.*60

          .         .         .         .         .         .       g.53466
 gggtgagccagggacagagacccaaggacatggaagcacacacagggacacacagactca       c.*120

          .         .         .         .         .         .       g.53526
 cgcatgttctaaggaacacatatacaagggtatacaaacacatagacatgcagagacata       c.*180

          .         .         .         .         .         .       g.53586
 gagtcagggactcctgcatcttcatggtccttcacatctccagtctcaccctctccaaat       c.*240

          .         .         .         .         .         .       g.53646
 ccatgctcctcaccagccctacaagccacttttgtaaaacgaaaaaatgatcagtagttc       c.*300

          .         .         .         .         .         .       g.53706
 tgctcacagctttccctaactcctatggcatattcaaggctctcagagtttccctaacaa       c.*360

          .         .         .         .         .         .       g.53766
 accatgctcactcctaccactggaccattgcatgtgcttttccttctgcatgaaacactc       c.*420

          .         .         .         .         .         .       g.53826
 ttcctttgttcctgtaggtgagtataattcatccttcaaatcctagttgttacctcttct       c.*480

          .         .         .         .         .         .       g.53886
 aggaggcctttcctgatgcctgccctagattgagtttggtcctgtcctctgggttcctat       c.*540

          .         .         .         .         .         .       g.53946
 agcccacccccaaccctccacgctcacagtatttatactgtgtagtaatcatctgtttac       c.*600

          .         .         .         .         .         .       g.54006
 ttgtctggatccctgacttagactgtgagatctttgagggcaaggaccttttctgaatca       c.*660

          .         .         .         .         .         .       g.54066
 tctatgtatccccagtgcctctcacataataggtgcttagtaaatatttgttaaaagaat       c.*720

          .         .         .         .         .         .       g.54126
 gaattaattaattaacaaaaaaggatcccataacatagcaatagacacacatatatacat       c.*780

          .         .         .         .         .         .       g.54186
 actcacaaccaaagacacaggatcacacccggaaaaacagtgacaagggcacagatatgg       c.*840

          .         .         .         .         .         .       g.54246
 atggatagagggacagacatttatggaaacacaggaatcacaaaacaaacatggacatag       c.*900

          .         .         .         .         .         .       g.54306
 gggtatagagacataaaaagatggggacagggagccagagtggcagaatcagggacataa       c.*960

          .         .         .                                     g.54342
 actcagagaaaaaggaacagatgctctctggctgca                               c.*996

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Inter-alpha-trypsin inhibitor heavy chain family, member 6 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.2.0 Build 33
©2004-2012 Leiden University Medical Center