galactosidase, alpha (GLA) - 217 nt intron 05 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.14239
gtaaaaacttgagccctccttgttcaagaccctgcggtaggcttgtttcctattttgaca  c.801+60

         .         .         .         .           g.14288
ttcaaggtaaatacaggtaaagttcctgggaggaggctttatgtgagag  c.801+109

--------------------- middle of intron ---------------------
 g.14289            .         .         .         .           g.14336
 c.802-108  tacttagagcaggatgctgtggaaagtggtttctccatatgggtcatc  c.802-61

.         .         .         .         .         .           g.14396
taggtaactttaagaatgtttcctcctctcttgtttgaattatttcattctttttctcag  c.802-1


Powered by LOVD v.2.0 Build 27
©2004-2010 Leiden University Medical Center