galactosidase, alpha (GLA) - coding DNA reference sequence

(used for mutation description)

(last modified July 16, 2010)


This file was created to facilitate the description of sequence variants in the GLA gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_007119.1, covering GLA transcript NM_000169.2.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
           .         .         .         .         .                g.5000
           aaacaataacgtcattatttaataagtcatcggtgattggtccgcccctg       c.-61

 .         .         .         .         .         .                g.5060
 aggttaatcttaaaagcccaggttacccgcggaaatttatgctgtccggtcaccgtgaca       c.-1

          .         .         .         .         .         .       g.5120
 ATGCAGCTGAGGAACCCAGAACTACATCTGGGCTGCGCGCTTGCGCTTCGCTTCCTGGCC       c.60
 M  Q  L  R  N  P  E  L  H  L  G  C  A  L  A  L  R  F  L  A         p.20

          .         .         .         .         .         .       g.5180
 CTCGTTTCCTGGGACATCCCTGGGGCTAGAGCACTGGACAATGGATTGGCAAGGACGCCT       c.120
 L  V  S  W  D  I  P  G  A  R  A  L  D  N  G  L  A  R  T  P         p.40

          .         .         .         .         .         .       g.5240
 ACCATGGGCTGGCTGCACTGGGAGCGCTTCATGTGCAACCTTGACTGCCAGGAAGAGCCA       c.180
 T  M  G  W  L  H  W  E  R  F  M  C  N  L  D  C  Q  E  E  P         p.60

          .     | 02   .         .         .         .         .    g.9024
 GATTCCTGCATCAG | TGAGAAGCTCTTCATGGAGATGGCAGAGCTCATGGTCTCAGAAGGC    c.240
 D  S  C  I  S  |  E  K  L  F  M  E  M  A  E  L  M  V  S  E  G      p.80

          .         .         .         .         .         .       g.9084
 TGGAAGGATGCAGGTTATGAGTACCTCTGCATTGATGACTGTTGGATGGCTCCCCAAAGA       c.300
 W  K  D  A  G  Y  E  Y  L  C  I  D  D  C  W  M  A  P  Q  R         p.100

          .         .         .         .         .         .       g.9144
 GATTCAGAAGGCAGACTTCAGGCAGACCCTCAGCGCTTTCCTCATGGGATTCGCCAGCTA       c.360
 D  S  E  G  R  L  Q  A  D  P  Q  R  F  P  H  G  I  R  Q  L         p.120

           | 03        .         .         .         .         .    g.11205
 GCTAATTAT | GTTCACAGCAAAGGACTGAAGCTAGGGATTTATGCAGATGTTGGAAATAAA    c.420
 A  N  Y   | V  H  S  K  G  L  K  L  G  I  Y  A  D  V  G  N  K      p.140

          .         .         .         .         .         .       g.11265
 ACCTGCGCAGGCTTCCCTGGGAGTTTTGGATACTACGACATTGATGCCCAGACCTTTGCT       c.480
 T  C  A  G  F  P  G  S  F  G  Y  Y  D  I  D  A  Q  T  F  A         p.160

          .         .         .         .         .         .       g.11325
 GACTGGGGAGTAGATCTGCTAAAATTTGATGGTTGTTACTGTGACAGTTTGGAAAATTTG       c.540
 D  W  G  V  D  L  L  K  F  D  G  C  Y  C  D  S  L  E  N  L         p.180

         | 04.         .         .         .         .         .    g.12259
 GCAGATG | GTTATAAGCACATGTCCTTGGCCCTGAATAGGACTGGCAGAAGCATTGTGTAC    c.600
 A  D  G |   Y  K  H  M  S  L  A  L  N  R  T  G  R  S  I  V  Y      p.200

          .         .         .          | 05        .         .    g.14038
 TCCTGTGAGTGGCCTCTTTATATGTGGCCCTTTCAAAAG | CCCAATTATACAGAAATCCGA    c.660
 S  C  E  W  P  L  Y  M  W  P  F  Q  K   | P  N  Y  T  E  I  R      p.220

          .         .         .         .         .         .       g.14098
 CAGTACTGCAATCACTGGCGAAATTTTGCTGACATTGATGATTCCTGGAAAAGTATAAAG       c.720
 Q  Y  C  N  H  W  R  N  F  A  D  I  D  D  S  W  K  S  I  K         p.240

          .         .         .         .         .         .       g.14158
 AGTATCTTGGACTGGACATCTTTTAACCAGGAGAGAATTGTTGATGTTGCTGGACCAGGG       c.780
 S  I  L  D  W  T  S  F  N  Q  E  R  I  V  D  V  A  G  P  G         p.260

          .         .  | 06      .         .         .         .    g.14435
 GGTTGGAATGACCCAGATATG | TTAGTGATTGGCAACTTTGGCCTCAGCTGGAATCAGCAA    c.840
 G  W  N  D  P  D  M   | L  V  I  G  N  F  G  L  S  W  N  Q  Q      p.280

          .         .         .         .         .         .       g.14495
 GTAACTCAGATGGCCCTCTGGGCTATCATGGCTGCTCCTTTATTCATGTCTAATGACCTC       c.900
 V  T  Q  M  A  L  W  A  I  M  A  A  P  L  F  M  S  N  D  L         p.300

          .         .         .         .         .         .       g.14555
 CGACACATCAGCCCTCAAGCCAAAGCTCTCCTTCAGGATAAGGACGTAATTGCCATCAAT       c.960
 R  H  I  S  P  Q  A  K  A  L  L  Q  D  K  D  V  I  A  I  N         p.320

          .         .         .          | 07        .         .    g.14885
 CAGGACCCCTTGGGCAAGCAAGGGTACCAGCTTAGACAG | GGAGACAACTTTGAAGTGTGG    c.1020
 Q  D  P  L  G  K  Q  G  Y  Q  L  R  Q   | G  D  N  F  E  V  W      p.340

          .         .         .         .         .         .       g.14945
 GAACGACCTCTCTCAGGCTTAGCCTGGGCTGTAGCTATGATAAACCGGCAGGAGATTGGT       c.1080
 E  R  P  L  S  G  L  A  W  A  V  A  M  I  N  R  Q  E  I  G         p.360

          .         .         .         .         .         .       g.15005
 GGACCTCGCTCTTATACCATCGCAGTTGCTTCCCTGGGTAAAGGAGTGGCCTGTAATCCT       c.1140
 G  P  R  S  Y  T  I  A  V  A  S  L  G  K  G  V  A  C  N  P         p.380

          .         .         .         .         .         .       g.15065
 GCCTGCTTCATCACACAGCTCCTCCCTGTGAAAAGGAAGCTAGGGTTCTATGAATGGACT       c.1200
 A  C  F  I  T  Q  L  L  P  V  K  R  K  L  G  F  Y  E  W  T         p.400

          .         .         .         .         .         .       g.15125
 TCAAGGTTAAGAAGTCACATAAATCCCACAGGCACTGTTTTGCTTCAGCTAGAAAATACA       c.1260
 S  R  L  R  S  H  I  N  P  T  G  T  V  L  L  Q  L  E  N  T         p.420

          .         .         .                                     g.15155
 ATGCAGATGTCATTAAAAGACTTACTTTAA                                     c.1290
 M  Q  M  S  L  K  D  L  L  X                                       p.429

          .                                                         g.15173
 aatgtttattttattgcc                                                 c.*18

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Galactosidase, alpha protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.2.0 Build 27
©2004-2010 Leiden University Medical Center